Transcript asmbl_16235

Sequence
Transcript Sequence for observation asmbl_16235 of TGE0032146:
CTCCCCGGCGTCTAAACACAGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAGTCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCATGGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTACAAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACGCCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGAGAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGCAAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGAAATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAGGATGTGACCTCCAAACAGGACTGGGACAAGTACTGCCACTACGTTGCTGGGCTGGTGGGAATTGGCCTTTCTCGTCTATTCTCTGCCTCAGAGTTTGAAGACCCCATAGTTGGTGAAGACATAGAGTGTGCCAACTCAATGGGTCTGTTCCTGCAGAAAACAAATATCATTCGTGATTATCTGGAAGACCAACAGGAAGGAAGGAAGTTTTGGCCTCAGGAGGTGTGGGGCAGATACATTAAGAAGTTGGAAGACTTTGCTAAGCCAGAGAACGTAGATGTGGCCGTGCAGTGCTTGAATGAACTCATAACCAACACCCTACAGCACATCCCTGACGTCCTCACCTACCTGTCAAGGCTCCGGAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTAATGGCCATTGCCACACTGGCTGCCTGTTACAATAACCAGCAGGTATTCAAAGGAGTAGTGAAGATTCGGAAGGGGCAAGCAGTCACCCTCATGATGGATGCCACCAACATGCCTGCCGTCAAAGCTATCATATACCAGTACATAGAAGAGATTTATCACCGGATCCCCAACTCAGACCCATCATCAAGCAAAACCAAGCAGGTCATCTCCAAGATCAGGACACAGAACCTTCCCAACTGCCAGCTCATCTCCCGAAGCCACTACTCCCCCATTTACCTGTCATTTATCATGCTCTTGGCTGCCCTGAGCTGGCAGTACCTGAGCACCCTGTCCCAGGTCACAGAAGACTATGTCCAGAGAGAACACTGATTTTGTTTAGCCGGAAGTGGAAGTTCCCGTGGAGTGGGTTTTTCCTTTTCCTCCAGCTGGATTTTGACTTCCCTTGTTTTTCCTCCTACTCTAAAATCTTTGGGAGAACTGAGTGTGGGACCTTTAGGAACTGGGCAGAGGAAAGGATGCCTTGCCCTCAGCAGCCTGGTGCTGGCTGGGACTTGGTTCCTCTGCCTCTTGTAGCCACTGGCAGCGTGCCGACTGCTGCACTTGTGAGGCCACGTGTGATGGTCACAAGAGCCTAGTGAACCTGGCTAGAATGCTGATTGGATTTATTTAATTTGAAACAGCCTTTGAATACCTATGACAATAGAAAATGAAAGCAA