Transcript asmbl_16183

Sequence
Transcript Sequence for observation asmbl_16183 of TGE0032142:
TTCAAAGTCCGGGGGAGCGACCTGGGAAGCGGAATTCGGGGCCTGAACCTCCGTGCCTTGACCTACTGATTGTTCCCTTTGCAGACCCTGCCTTCCTCTCAGTCCACACTCCGAGCCGTAGACGTCGGGTTTCCAGCTCCGTCTGTGCACACATAACTCCAGGAAGCCGCTAGCTCCCGACGATGTCTTCTGTCAAGTTATGGCCTACTGGTGCGTCAGCGGTTCCTCTGGTGAGCCGTGAAGAACTGAAGAAGCTGGAGTTTGTGGGTAAAGGAGGGTTCGGAGTCGTGTTCCGGGCACACCACAGAACATGGAACCATGATGTAGCAGTCAAGATCGTGAACTCGAAGAAGATATCCTGGGAGGTGAAGGCTATGGTTAATCTTCGTAATGAGAACGTTCTGCTCCTGCTGGGGGTCACTGAGGACCTCCAGTGGGACTTCGTGTCCGGGCAGGCTCTGGTGACAAGATTCATGGAGAATGGCTCCCTCGCAGGGCTGCTGCAACCCGAGTGCCCTCGGCCCTGGCCACTCCTCTGTCGCCTGCTGCAGGAAGTGGTGCTGGGGATGTGCTACCTACACAGCTTGAACCCTCCGCTCCTGCACCGGGACCTCAAGCCCTCTAACATTCTGCTGGATCCAGAGCTCCACGCCAAGCTAGCAGATTTTGGCCTGTCCACGTTTCAGGGAGGGTCCCAGTCAGGGTCAGGATCAGGATCAGGATCCAGGGACTCTGGGGGCACCCTAGCGTACTTGGACCCAGAGCTGTTATTTGATGTCAACCTGAAGGCTTCTAAAGCGAGTGATGTCTACAGCTTTGGGATCCTCGTGTGGGCAGTGCTGGCTGGCAGAGAAGCTGAGTTGGTAGACAAGACTTCACTAATCCGGGAAACAGTGTGTGACAGGCAGAGTCGTCCTCCACTGACAGAGCTGCCTCCAGGTAGCCCTGAGACTCCCGGCTTGGAAAAACTGAAGGAGTTAATGATTCATTGCTGGGGTTCCCAGTCCGAAAACAGGCCATCCTTCCAGGACTGCGAACCAAAAACCAATGAAGTTTACAATCTGGTAAAGGACAAGGTAGATGCTGCTGTCTCCGAGGTAAAGCATTATCTGTCTCAGCACAGAAGCAGCGGCAGAAACTTGTCTGCCAGAGAGCCAAGCCAAAGAGGCACAGAAATGGATTGCCCGAGGGAAACCATGGTTTCTAAAATGCTGGACCGCCTGCATTTGGAGGAACCCTCCGGACCAGTTCCTGGAAAATGTCCTGAGAGGCAAGCACAGGACACATCAGTTGGGCCTGCCACACCAGCAAGGACATCTTCTGACCCCGTGGCTGGCACTCCTCAGATTCCACATACTTTACCCTTCAGAGGCACAACACCTGGGCCAGTCTTTACTGAGACTCCCGGTCCTCACCCCCAAAGGAATCAGGGAGATGGAAGACACGGCACTCCTTGGTATCCCTGGACCCCACCGAATCCAATGACAGGGCCACCGGCTCTCGTCTTCAACAACTGTTCTGAAGTGCAGATTGGGAACTACAACTCCTTGGTAGCACCACCAAGAACTACTGCCTCAAGTTCGGCCAAGTATGACCAAGCACAGTTCGGCAGGGGTAGGGGCTGGCAGCCCTTCCACAAGTAGACTTCAGAGAATCACTGCAAGAGCCTGAAGTGTGCCATTCAGCGTGGCAATAAAAAGCACGTTTTAAGCAACCTGGACTGGCTAAGACAGTCCTTGCCACTTCCTGAAGCTCACAACATTCTGTGAGGACAGTTGGACCTACACCCAAACTGACTCTTGACCCATCTCCTTAAAGTCAATAAACATAGCATGTTAACTGTGA