Transcript asmbl_16159

Sequence
Transcript Sequence for observation asmbl_16159 of TGE0032163:
GAAAGCGAAAGCTGGGGCTGCTAGCCCAGGCTCGAGAGCTGCCAAGTGGGGGGAAGCATGGCCAAGCCTTGTGGGGTCCGCTTGAGTGGAGAAGCCCGAAAACAGGTGGATGTCTTCAGACAAAATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCCCTGAGTCAGCTCTTGCAGGAGGATTCCCTCAATGTGGCCGACCTCTCCTCCCTCCGGGCTCCTCTGGACATCCCTATCCCAGATCCTCCACCCAAGGATGACGAGATGGAAACAGACAAGCAGGAGAAGAAGGAAGTCCCTAAGTGTGGCTACCTCCCGGGGAACGAGAAGCTTCTGGCCTTGCTCGCTTTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAGTGCATTCTGGTAATCACATGGATCCAGCACCTGATCCCCAAGATTGAGGATGGAAATGATTTTGGGGTGGCAATTCAGGAGAAGGTGCTGGAGAGAGTGAATGCTGTCAAGACCAAAGTAGAAGCTTTCCAGACAACCATTTCCAAGTACTTCTCAGAACGAGGGGACGCTGTAGCCAAGGCTTCCAAGGACACCCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAAGCAGCCTATGGGGCGCTTAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAGCAGCAACCTAGAGAAAATCGTCAACCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATGATTTATACTTTATGTAT