Transcript asmbl_14748

Sequence
Transcript Sequence for observation asmbl_14748 of TGE0032043:
CCGCCCGCAGCACCCGTCCTCGGTCACTGCTGGTCGCTTCCTGAGCCGCTGCTGGCTCTGTGTCTCTGTCCTCAGCGTTCTCGTCCTCGTCCTCGTCCTCGTCCTACCACGCCATGGAAGGTTACCATAAGCCAGATCAGCAGAAGCTCCAGGCCCTGAAGGACACAGCCAATCGCCTGCGCATCAGCTCCATCCAGGCCACCACCGCGGCAGGCTCAGGCCACCCCACATCATGCTGCAGCGCTGCCGAGATCATGGCTGTCCTGTTTTTCCATACCATGCGTTACAAGGCCCTGGATCCCCGAAACCCTCACAATGATCGATTTGTGCTCTCTAAGGGCCATGCAGCTCCCATTTTATATGCAGTCTGGGCTGAAGCTGGCTTCCTACCCGAGGCCGAGCTGCTGAACCTGAGGAAGATCAGCTCTGACTTGGACGGGCATCCTGTCCCGAAACAAGCCTTCACCGATGTGGCCACTGGCTCCCTGGGCCAGGGCCTGGGAGCTGCTTGCGGGATGGCATACACAGGCAAATACTTTGACAAAGCCAGCTACCGAGTCTATTGCATGCTGGGAGACGGGGAGGTCTCCGAGGGCTCCGTCTGGGAGGCCATGGCCTTTGCTGGAATTTACAAGCTGGACAACCTCGTTGCCATTTTTGACATCAACCGCCTGGGCCAGAGCGACCCAGCCCCGCTGCAGCACCAGGTGGACATCTACCAGAAGCGCTGTGAGGCCTTTGGCTGGCACACCATCATCGTGGACGGACACAGCGTGGAGGAGCTGTGCAAGGCCTTTGGTCAGGCCAAGCACCAACCAACAGCCATCATTGCCAAGACCTTCAAGGGCCGAGGGATCACAGGGATTGAAGACAAGGAGGCGTGGCACGGGAAGCCCCTCCCCAAAAACATGGCCGAGCAGATTATCCAGGAGATTTACAGCCAGGTTCAGAGCAAAAAGAAGATCCTGGCCACGCCCCCTCAGGAGGATGCCCCATCCGTGGACATTGCTAACATCCGAATGCCTACGCCACCCAGCTACAAAGTGGGGGACAAGATAGCCACCCGGAAGGCCTATGGACTGGCCCTCGCTAAGCTGGGCCACGCCAGTGACCGTATCATTGCCCTGGATGGAGACACCAAGAATTCCACCTTCTCGGAGCTCTTCAAAAAGGAGCACCCAGACCGGTTCATTGAGTGCTACATTGCCGAGCAAAACATGGTGAGCATTGCCGTGGGCTGTGCCACACGTGACCGGACAGTGCCCTTCTGCAGTACTTTCGCGGCCTTCTTCACACGGGCCTTCGACCAGATTCGCATGGCCGCCATCTCTGAGAGCAACATCAACCTCTGTGGCTCCCACTGTGGTGTGTCCATTGGGGAAGACGGGCCCTCTCAGATGGCCCTCGAAGACCTGGCCATGTTCCGGTCAGTCCCCATGTCCACCGTCTTTTACCCAAGCGATGGAGTTGCAACAGAGAAGGCAGTGGAGTTAGCAGCCAACACAAAGGGCATTTGCTTCATCCGGACCAGCCGCCCAGAGAATGCCATTATTTATAGCAACAATGAGGATTTCCAGGTCGGCCAAGCCAAGGTGGTCCTGAAGAGCAAGGATGACCAAGTGACAGTGATCGGGGCTGGTGTAACTCTGCATGAGGCCTTGGCTGCTGCAGAGAGTCTAAAGAAAGATAAGATCAGCATCCGGGTGCTGGATCCCTTCACTATCAAGCCCCTGGACAGGAAACTCATCCTAGACTCTGCCCGAGCAACCAAAGGCAGGATCCTCACCGTGGAGGACCACTACTACGAAGGTGGCATAGGAGAGGCAGTGTCTGCTGCCGTAGTGGGTGAACCTGGAGTGACGGTCACTCGCCTGGCTGTCAGCCAAGTACCACGAAGTGGCAAGCCAGCTGAGCTACTGAAGATGTTCGGTATTGACAAGGACGCCATTGTGCAAGCTGTGAAAGGCCTTGTCACCAAGGGCTAGGGAGGGCATGGGATGCTGGGTGGGTGAACTACACATTCCAGGGAGGTTCTGGCAGAGGTGGCGAAGGTGTACTGAGTGGGGAGGTAAATATATGTTTTGAGAAAAAA