Transcript asmbl_14711

Sequence
Transcript Sequence for observation asmbl_14711 of TGE0003333:
CGCTGGGGTCCTTCCTTGCGCGTTGATATGATTGGTCGGCAGTGAGCGGTCCTCTTTTCCTCCTCTCCAGCTCCGGCGCCGTAGCCATCATGAATGACACAGTAACCATCCGGACCAGGAAGTTCATGACCAACCGTCTGCTTCAGAGGAAACAGATGGTCATTGATGTCCTTCATCCTGGGAAGGCAACAGTACCAAAGACAGAAATTCGGGAAAAGCTGGCCAAAATGTACAAAACCACACCAGATGTCATCTTTGTATTTGGATTCAGAACCCACTTCGGTGGTGGCAAGACCACTGGCTTTGGCATGATCTATGATTCTTTAGATTATGCAAAGAAGAATGAGCCTAAACACAGACTGGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACAGCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGTGGAGATTGGATACAGCCAAAGGAGTAGATCTGCGGTGACTTGATGTTTTGCTGTGATGTGCAGATTTCTGAGAGGACAAATAAACTAAAAAGCTCCTACACGTCTGCTCTGCTGCTTATTGGGCATTAGAAGAATCAGGTGGCTGCTTGGGTGTTGATGCAGTCAAGTGCACTGGGCTTGGTGAAAAGCCCAGTGTAAGAGGCCGGTACAGATCCTTCCTGGCAGAGGGTGGTGATGGAGAGAACATAAATAACTACATGGGCAAAGTGTAGGACCAATTACCCTGTTAGCATCGTCTTTGCTCAACACCTTTCTGTGTCCCTAGACTCTGAGTTTTTTTCTAATTGATTTTTATTGAACACTGAGTGTTTTGAGGTTTTATTTTTTTAAGATTTATGTATGTGAGTACACTGTAGCTGT