Transcript asmbl_14679

Sequence
Transcript Sequence for observation asmbl_14679 of TGE0032032:
AGGTTCCGGCTCGCTTCGCCCTCCCAGCATGTTGAAGGGCATTAGAGGATTGGTCTTTACTGCTTAGTGAACCGGCCCTCTTCGTGGCCCTAGAGGCTGGCTTGGCTTCCGGATCTCGATCTCTGGAGCGCTCAAGCCTCCGCATCTCGGGTGAGATCAAATCGGGGATGCTCTCATAATGAATGTCAACCAGTCAGCTCCACCTGTTCCACCATATGGGCAGAACCAGCCCATCTACCCAGGGTATCATCAGTCGAGTTATGGTGGGCAACCAGGACCTGCAGCCCCTGCTACTCCCTATGGAGCCTACAATGGCCCAGTGCCAGGTTATCAGCAGGCACCTCCTCAAGGTGTGCCAAGAGCCCCACCTTCCTCAGGGGCACCTCCAGCCTCTGCAGCACAGGTCCCTTGTGGTCAGACTACATATGGCCAGTTTGGCCAAGGTGATATACAGAATGGGCCGAGTTCCACAGCTCAGATGCAAAGGGTCCCTGGTTCTCAGCAGTTTGGTCCTCCATTGGCCCCTGTGGTCAGCCAGCCAGCTGTGCTTCAGCCCTATGGCCCTCCCCCCACAAGTACACAGGTGACTGCACAGCTGGCCGGAATGCAGATCAGTGGTGCTGTGGCCCAGGCCCCTCCCCCTTCTGGGTTGGGCTATGGTCCACCAACATCATTGGCCTCAGCCTCAGGAAATTTCCCTAATTCTGGTCCATACGGCTCCTATCCTCAGAGCCAGGCTCCTCCCCTTAGCCAGGCTCAAGGTCATCCTGGAGTCCAGCCTCCCCTTCGATCTGCCCCACCTCTGGCTTCCAGCTTCACGTCCCCAGCTTCAGGTGGTCCTCAGATGCCTTCCATGACTGGACTACTCCCGCCTGGACAGGGCTTTGGGAGTCTTCCAGTGAACCAGGCTAACCACGTGTCCTCACCTCCTGCTCCTGCTCTGCCCCCGGGCACCCAGATGACTGGGCCCCCAGTACCACCGCCACCACCTATGCACTCCCCTCAGCAGCCTGGTTATCAGCTGCAGCAAAATGGTTCCTTTGGACCAGCTCGAGGCCCTCAACCTAATTATGAGAGCCCATACCCTGGAGCACCTACCTTTGGCAGTCAGCCTGGGCCTCCCCAGCCATTGCCTCCTAAGCGTCTGGACCCTGATGCCATCCCCAGCCCTATTCAGGTTATTGAAGATGATAGAAACAACCGGGGTTCAGAGCCATTTGTTACTGGTGTACGGGGACAGGTGCCACCTTTAGTCACCACCAATTTCCTGGTGAAAGACCAAGGGAATGCAAGTCCCCGCTACATTCGATGCACATCCTATAATATCCCTTGTACTTCTGACATGGCTAAACAGGCTCAGGTGCCTCTGGCCGCTGTCATTAAACCACTGGCAAGGCTGCCTCCAGAGGAGGCTTCACCGTATGTTGTGGATCATGGAGAATCTGGCCCCCTGCGCTGTAATCGCTGCAAAGCATACATGTGCCCTCTCATGACATTCATCGAGGGAGGGAGGCGCTTCCAGTGCTCCTTCTGCAGTTGTGTCAATGATGTTCCCCCCCAGTATTTTCAACATCTGGATCATACCGGCAAACGTGTGGATGCTTATGACCGTCCTGAGCTGTCTCTGGGATCTTATGAATTCTTGGCTACTGTAGATTACTGTAAGAACAATAAATTCCCTAGTCCTCCTGCCTTCATCTTTATGATTGATGTCTCCTACAATGCCATCAGAACTGGTCTTGTTCGGCTCCTCTGTGAGGAGCTCAAGTCACTCTTAGACTACCTACCTAGGGAGGGTGGAGCAGAAGAGTCAGCAATCCGAGTTGGCTTTGTCACCTATAATAAAGTGCTCCACTTCTACAATGTGAAAAGCTCCTTGGCTCAGCCACAGATGATGGTTGTATCTGATGTAGCTGACATGTTTGTGCCACTGCTGGATGGCTTCCTAGTCAATGTCAGTGAGTCTCGGGCTGTTATCACCAGCTTATTGGATCAGATTCCAGAAATGTTTGCAGATACAAGAGAGACAGAGACAGTGTTTGCTCCAGTTATCCAGGCCGGGATGGAAGCTCTGAAGGCTGCTGAGTGTGCAGGAAAGCTGTTTCTGTTCCACACATCCTTGCCCATTGCAGAGGCCCCAGGGAAGCTGAAGAATAGAGATGATAGGAAGTTGATCAACACAGACAAGGAGAAGACTCTGTTTCAGCCTCAGACAGGTACCTATCAGACTCTGGCCAAAGAGTGTGTGGCCCAAGGCTGCTGTGTGGACCTCTTCCTCTTCCCTAACCAATATGTCGATGTGGCCACACTCTCTGTTGTTCCCCAGCTCACTGGAGGCTCTGTCTACAAATATGCCTGCTTCCAGGTGGAAAATGACCAGGAACGGTTCTTGAGTGACCTGCGTCGGGATGTACAGAAGGTGGTTGGCTTTGATGCTGTTATGCGGGTTCGGACAAGTACTGGTATCCGTGCTGTAGATTTCTTTGGCGCTTTCTATATGAGCAATACAACAGATGTGGAGTTGGCTGGATTGGATGGAGACAAGACAGTGACTGTGGAATTCAAGCATGATGACCGGCTCAATGAAGAGAATGGAGCCCTACTGCAGTGTGCCCTGCTTTATACCAGCTGTGCAGGGCAGCGTCGGCTCCGCATCCACAACTTGGCCCTAAACTGCTGCACCCAGCTGGCTGATCTGTATCGAAACTGTGAGACTGACACGCTCATCAACTACATGGCCAAGTTTGCATACCGGGCTGTTCTGAATAGTCCTGTGAAGACTGTCCGTGACACTCTCATCACCCAGTGTGCCCAGATCCTGGCCTGTTATAGAAAGAACTGTGCCAGCCCTTCTTCTGCAGGACAGTTGATTCTTCCTGAGTGCATGAAGCTCCTCCCAGTTTACCTGAACTGTGTGTTGAAGAGTGATGTTCTGCAGCCTGGAGCTGAGGTCACTACTGATGATCGTGCCTATGTTCGGCAGCTGGTTTCCTCCATGGATGTGGCTGAGACCAATGTCTTCTTCTACCCTCGGCTCCTACCACTGACAAAGTCTCCCCTTGATAGTACCGCTGAACCACCAGCAGTTCGAGCCTCTGAAGAGCGCCTAAGCAGTGGCGATATATATTTGCTGGAAAATGGGCTCAACCTCTTTGTCTGGGTGGGAGCAAGCGTCCAACAAGGTGTTGTCCAGAGCCTTTTCAACGTGTCCTCCTTCAGTCAGATCACCAGCGGCTTGAGTGTTCTGCCAGTTCTGGATAATCCACTGTCTAAGAAAGTTCGAGGTCTCATCGATAGCTTACGGGCACAGAGAATGCGGTACATGAAGCTTATCGTGGTCAAGCAGGAAGACAAGCTGGAGATGCTGTTCAAGCACTTCCTGGTGGAAGACAAGAGCCTAAGTGGAGGTGCATCCTATGTGGACTTTCTCTGTCATATGCACAAGGAGATCCGGCAGCTACTGAGCTAAAGCAAGTGGGTAAATGGCATAGGGTCCCAGGCCAGCTTCCAGGAAGAACCCCAGGATGACAGAGAAATTGGGACAGTTCCATATCGTATAAGTCATGTAAGCTGACCTCAGTTGACTTCTTTTGGGGGGAGGGCGAGATATAAGGAGACACCGTCTTTCTGGGCTCAAATACACTACCACTCTGTCATGTCCTGCTGATCGAAGGTGCCTCAGGCCCCTTACTCTACCCTTTCTCCTGCTAATCCTCTTGTAATGAATGTAGTTTCTCAGTTCACTGTATATGATTCGGTGTTGGGGGTTTGGAGGCAGCTGGGCCCTGGCAACAGTGTGTCCCTTTGGATGAGCCTCCAAGAGGAAGGGCAGGCAGGAAGAAGTGGGAATCCCAGGGTTATTACAGGAGGTGGCAAATTCAGCTCCGTGTCATCAACAACTTCCTATATTAGGGACAAAATATACAGGTGCACAAGAGCTGGGGTACAGGCCGTAGGTGGTGGAGAGTAAAATAGTTGGTCCTTTGGGTGCCTGATGGTCAGTAGCAAAGTCATAGTTACCGAGGATGGATGACTAATCTCTCTACTTCCACTGCGCGTGCTCTCTCTCCCCTGCAATGATTGGTGAGCACTTCGTGGATGAATGAGCCTGGGGTAAGAATTGCAAAACATATTAACACCTTGGGGAAGTAGCAGCCTCCTTTCCAGATGGAGAAGCCCCAATCCTGGATGGTTCTGTAGAGCGCCTGATGGTCAACTTGCAATACCTCACAGAGCCAGCCCACATCCCACTCAGCTTCCACCAGAAACGTTGTTGGGGAGAGGCAGATATGGCTGGAGCCCTGTCTTCCGGTGCCAGGACGTTACTGGGCTTTGGTATTGACTGAGTGGCTGACAAGTTATCTTCCAACTCCAGTTGGCTGGGCAGGACAAGGGCTAGGAATGACCGTGGTCAGGCCTGCCTGCTCCCAGCCCAGGATGCCCCTGCTATGGACCTTTCATTTCTTTTCATTGGTTTATTTTTCAATGCATCTTTAATTTGTAAAGAAATAAAATAAGATGTAACCAGTATCCCTCTCATTACTCGCGACTTTTCC