Transcript asmbl_13312

Sequence
Transcript Sequence for observation asmbl_13312 of TGE0031983:
GGAGCACAAAACCAGAAGTCCCTGCCTTGTACAGGCAGCTCTGAAAGCCTACTGGGAGCATCAAGGCTGCAAACGCTGGATTGAGAAGCCGCAACTGTGACTCTGCATCATGAATACTCTGTCTGAAGGAAATGGCACCTTTGCCATCCATCTTTTGAAGATGCTATGTCAAAGCAACCCTTCCAAAAATGTATGTTATTCTCCTGCGAGCATCTCCTCTGCTCTAGCTATGGTTCTCTTGGGTGCAAAGGGACAGACGGCAGTCCAGATATCTCAGGCACTTGGTTTGAATAAAGAGGAAGGCATCCATCAGGGTTTCCAGTTGCTTCTCAGGAAGCTGAACAAGCCAGACAGAAAGTACTCTCTTAGAGTGGCCAACAGGCTCTTTGCAGACAAAACTTGTGAAGTCCTCCAAACCTTTAAGGAGTCCTCTCTTCACTTCTATGACTCAGAGATGGAGCAGCTCTCCTTTGCTGAAGAAGCAGAGGTGTCCAGGCAACACATAAACACATGGGTCTCCAAACAAACTGAAGGTAAAATTCCAGAGTTGTTGTCAGGTGGCTCCGTCGATTCAGAAACCAGGCTGGTTCTCATCAATGCCTTATATTTTAAAGGAAAGTGGCATCAACCATTTAACAAAGAGTACACAATGGACATGCCCTTTAAAATAAACAAGGATGAGAAAAGGCCAGTGCAGATGATGTGTCGTGAAGACACATATAACCTCGCCTATGTGAAGGAGGTGCAGGCGCAAGTGCTGGTGATGCCATATGAAGGAATGGAGCTGAGCTTGGTGGTTCTGCTCCCAGATGAGGGTGTGGACCTCAGCAAGGTGGAAAACAATCTCACTTTTGAGAAGTTAACAGCCTGGATGGAAGCAGATTTTATGAAGAGCACTGATGTTGAGGTTTTCCTTCCAAAATTTAAACTCCAAGAGGATTATGACATGGAGTCTCTGTTTCAGCGCTTGGGAGTGGTGGATGTCTTCCAAGAGGACAAGGCTGACTTATCAGGAATGTCTCCAGAGAGAAACCTGTGTGTGTCCAAGTTTGTTCACCAGAGTGTAGTGGAGATCAATGAGGAAGGCACAGAGGCTGCAGCAGCCTCTGCCATCATAGAATTTTGCTGTGCCTCTTCTGTCCCAACATTCTGTGCTGACCACCCCTTCCTTTTCTTCATCAGGCACAACAAAGCAAACAGCATCCTGTTCTGTGGCAGGTTCTCATCTCCATAAAGACACATATACTACACAGGGAGAGTTCTCTCTTCAGTATCCCTACCACTCCTACAGCTCTGTCAAGATGGGCAAGTAGGGGGAAGTCATGTTCTAAGATGAAGACACTTTCTTCTTGTCAGCCTGATCTTATAATGCCTGCATTCAACTCTCCCTGTCTTGAATGCATCTATGCCCTTTACCAGGTTATGTCTAATGATGCCAAATACCTTCTGCTATGCTATTGATTGATAGCCTAGCCAGTAATTTATAGCCAGTTAGAACTGACTTGACTGTGCAAGAATGCTATAATGGAGCTAGAGAGAAGGCACAAACACTAGGAAAGGTTGCTGTTTTTGCAGAGGACACAGGGACATTTCCCACCACTCACATGGCTGCTTACAACCTCTGGAAATTCCAGTTTCTGTCCATGACTTGATTCCTTTCTTTGGCTTCTACTGGCTCCAGCATCCTGCACATACATGTATCGTCATTCAGTTACACACAAACAAGTAAAATTTTAAAAATAAATAAAAATTTAAAGAGAGAGTCTAAAATTTTAGTAATGGTTAGATAATAGCTGCTATTGTGCCTTTTTCAGGTTTTAATGTCATTATTCTTGTGTATAAAGTCAATAATTTATAGGAAAACATCAGTGCCATGCTGTGATCTTATCTTCATCCCCTTTCAAACACATTGTTTAACCATCAAGCAGTGACTCTCCATTCTTCCTCCCTTTGGACATATAACCACCAATCTTCTCTCTGTCTCTGTAGCTTTATCTATTTTGGACATTTTATATAGACTGCCTCTTTGCTATCTTGATAATGTCCTTTGATGCATACAGATTGCTTTTTTTCCAGTGATGTTCTCCTTATTTAATACTGTTCTGATCATGAGGTATGCATGCTGCAGCTAAGAATCTCACTACTAAAGTCAAGTATAGAAATAACTGTTCTTATGTTTTCCTCCAAGGCCTTCATGGATTATACCTTATATATCTAGGTCACTGTTCCAGTTTGAATTAAATTCCATATGTGGTGTGGTGTTGGAGCCTGATGTGATTCCTTTATTTGTGAACATCCAGTTGTCGCTGTACTTGTAATTGCTTTGAATCATGAGGTAATGACCAATGAATAGGAAAAATAATGTTACAACTAGTGGGGTAGGATAGAAGTTCCTCAGTACATATATTGAACATTAACACAAGTGTGAAATAAAAATATCAGAAATGAGCAGTAAACAAAGAAGGAGAGATTAAACGTTCTGTAATCAGGGTCCTCAGAAATGACTCAGGGGCTGAAGATGCTTGCTACCCTGCCTGACAACTTGAGTTCTATTTCTGGAACAGACATGGTGGAAGAAGAAAACTGACTCTAGCAAGTTGTCCTCTGACCTCACCATGAGCATGATGCACAAATAAATATCCCTGTTAATCAGATATAATTATGCAGTAAGTTAATAATCAGAAAAAATACACATATAAAAACCAATTCCTTATCAACAAGTTAATCTTGCTAGGAAGAGCCAGGAAAAAGAGTAATAGGGGACCATGTGATCCTAAAAGGGATAAAGCTAAGCCAGGATATACTCTTATACATCAACATGTGTCCTGGTTTCCAGAAGGTTCAATTTGAGGACATATCCCAATGATGTCATTACTGAAGTCCACAAAAAGACAGTGACTATGATCTCTGTAGCCATATTTATAGCAGCAAATAATGGATCCAGGTGTCAATCTCATACAGTAAACAAAGAAGTCATGTTGTACACTTAATACTGAATGGAAGTTAGAAAGTTGTACCAGATAGTTTTTATATTAATGTGATACAAGGTAGAGTCACTGGAGAGGAAAGAGCCTCAATTAAGAAATGTCTCCATATGCTCTGGAGCATTAATGTGAGAAGGCTAGGCCCATTGTATGTGAGACAATCCCTATGCAGGTGGTCCTCTGATTATAAGGAAGCAGGCTGAACAAACCAGGAGGAGCAAGCCAGTAAGCAGC