Transcript asmbl_11601

Sequence
Transcript Sequence for observation asmbl_11601 of TGE0031860:
GGGTCGCTTTGGTGGATGCACTTCCGGCGGTGGCGATTTGGAGGACTGAAGGAAGATGGGTCAAAGCCAGAGTGGTGGCCATGGTCCTGGGGGTGGCAAGAAGGATGACAAGGACAAGAAAAAGAAATACGAACCTCCTGTCCCAACTAGAGTGGGGAAAAAGAAGAAGAAAACAAAGGGACCAGATGCTGCCAGCAAACTGCCACTGGTAACACCTCACACCCAGTGCCGCCTGAAATTACTGAAGCTAGAGAGAATAAAAGACTATCTTCTCATGGAGGAGGAATTCATTAGAAACCAGGAACAGATGAAACCATTAGAAGAAAAGCAAGAGGAGGAAAGATCAAAAGTGGATGATCTCAGGGGGACCCCCATGTCTGTAGGAACCTTGGAAGAGATCATTGATGATAATCACGCCATTGTGTCCACATCTGTGGGCTCAGAACACTACGTCAGCATCCTGTCGTTTGTAGACAAGGATCTGCTGGAACCAGGCTGCTCCGTCCTGCTCAACCACAAGGTGCATGCTGTGATAGGGGTGCTAATGGATGACACGGATCCCCTGGTCACAGTGATGAAGGTGGAAAAGGCCCCCCAGGAGACCTACGCAGATATTGGGGGACTGGACAACCAGATCCAAGAAATTAAGGAGTCTGTGGAGCTCCCGCTTACCCATCCTGAGTATTACGAGGAGATGGGGATAAAGCCCCCTAAGGGGGTCATTCTCTACGGTCCGCCAGGAACAGGTAAAACTCTATTGGCCAAAGCAGTAGCGAACCAGACTTCAGCCACTTTCTTGCGAGTGGTTGGCTCAGAGCTTATCCAGAAGTACCTAGGTGACGGGCCCAAACTTGTCCGGGAGCTCTTCCGGGTCGCTGAGGAGCATGCGCCGTCCATCGTGTTCATTGATGAGATCGACGCCATTGGGACCAAAAGATATGATTCAAATTCTGGAGGTGAGAGAGAAATTCAGCGAACAATGTTGGAACTGTTGAACCAGTTGGATGGATTTGATTCGAGGGGAGATGTAAAAGTTATCATGGCCACAAACCGAATAGAAACTTTGGATCCAGCACTTATCAGGCCAGGCCGCATTGACAGAAAGATCGAGTTCCCCCTGCCGGATGAGAAGACCAAGAAGCGTATCTTCCAGATTCACACCAGCAGGATGACACTGGCTGATGATGTAACCTTGGATGACTTGATCATGGCAAAGGATGACCTCTCTGGGGCCGACATCAAGGCAATCTGTACAGAAGCTGGCTTGATGGCCTTGCGGGAACGCAGAATGAAAGTAACAAATGAAGACTTCAAAAAATCTAAAGAGAATGTTCTTTATAAAAAACAAGAAGGCACCCCTGAGGGGCTCTATCTCTAGTGGCCCACAGTCGTCCTCAGGGATGGGGAGCTGTCCCCAGGAACCCATTCTCCAGTTCAGGTTTGCCAGTAGAAAGCCTGTATCGTGGAGGACACTGTGCCTCCATCTGTTGTTGGTCATTGTGCCGTGCTGCTCTCTACTCCCAATAAAGGATTGGCCTGGTTTGCTTTCT