Transcript asmbl_56190

Sequence
Transcript Sequence for observation asmbl_56190 of TGE0006435:
GTGTGTGTGTCGATATGTTTGAGAAGCTTTGGATAAAGATTGCATAGATCAATTTATGACGAGAGTGAAAGCGAAAATTTTAAAGGAGTGATTTATACCGTTTCACTTTCGGTTTGGAACATTAATGGATTTCTGCTTTTTAAGGAGGCGGCTGTAATGGGGAACATGAAACTTTCAGTTCTCCAGTTAAAAATCGAAAACTGCTTTTTTAAAACCTTTTTTCTTTTTGATTTGATTTAAAAACTGTATCCTCGCTTATTCTGCTGTCTATAACGGAAGTTTTGTAGGTTTCGCAACGGTGGTTTCACTTTTGTTAAAACGTTAAGCGGGGTGGAGTAGACTCTCTGGAATACACGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAGGAGGAGGGTGGGCAGGGGACAGGGACCTGGACGGTGAGAGGAGGAGACTGGGGGCGGGGGCGTGGGTGCTGGTCCTGACAGGTGATCTGAGGACGGAGCCGCCTGCGGCCTGCTCTGCCATCCCCGGCCGCCAGCCGGGTCTGCAGTGTGACGCCGCGCCCACTGGGTCCTTTCCCCGCAGAGTGAAAGGGACTGGGGAATAGGGTGGCCCTGCGGAAGGGCTTGGGGTGGCGAGTTAACGGGGAGAGCGAGCTCCCATCGGTCTCTCTTCTGCCCTCCTGGGCCCCCTGACGGGTGGGGGTGCCACTTCACTGCTGATCTTTTCCTTCTTCCCATGATGCAGCTCTGCCTTCCTGCTTCCTCCTCGCTGTCCCGCCCCGATTGTCCTTCAAATCTTCAGTCATTCCAGGTGCTTTGGGGGCATAAAGGTGAGGCGGCGGCTCCAGTGGCCATACCAAATCGTGCCCGGACACTTTCAGCCCGAAACCAGTGTTTCAAGCTCTTAGTGTAGTTAAATATGCACTTGAAATTCAGAATTTATATGTATTGAGAATTCTTCACAAAAGTAAAATCTTTTATTAAATCAGAAAGTTTTAAATGCTAACAGAAGCAACTTATTTTTAATTAGCATTTTCAGACTCTGCTATCATGTTAAACTCAACGCTGGCTAAGATACCTACCAGAGATCAAGGCATATTTTCTCCAGGTTTTGTGGGGTTTTTTTGGTACATCTATATTACAGAAGACTATTTCTAAAGATACGTGTTTGGCCTCTTAATTGGCCCGACTAACCATTCTCGTCGCGCCGTGAATGCCTCTGTAGTTGTCTATTAATCGAGAACTCATCCCAGCACCAAGACACAGCTGGTGGCGTCGGGGACAGACTGACTCAAGTACCGGATGTGTTCCCAGGACTCTTCCTGCCGTCCCGGAAGTCGCTGGACATTCCTATGACAGGGCAGATGGCTCACTGCCGTGTCCCGTCGGGGCTGGCTGAAATGCTTTGACTTTTTCACTTACTGTTTTCATGACGCTTGGACAGCAGTCCAATTGGAATGGGTGGAAATGTGATTCTTTTAAAATGGATGATTCAGAAAGAAATAAAAGGTAGAAAATATATTCAAAA