Transcript asmbl_56161

Sequence
Transcript Sequence for observation asmbl_56161 of TGE0006430:
GTACACCTTAGAAAAACACCAGCTGTACCTGTGCTAGAAAATTCTTAGGGCAGGGACCAAGGTCCTGCTGGGTGATAAGCCCAGAAAGAAACTGAGTTAGCTCTCTGCCTTCAACAATTCCATTGTAGGCTGTCCCCTGGCTATGTGGACGCTGGGGCAGAGCCAGCCCGGAACCGAATGATCAGCCAGGAAGAGTTTGCCAGGCAGCTGCAGCTCTCTGACCCACAGACCGTAGCTGGTGCCTTTAACTACTTCCAGAAGGATGCCAGCGGTTTGGTGGACTTCCGAGATGTGGCCCTTGCACTGGCAGCTCTGGATGGGAGCAGGGACCTTGAGGAGCTGACTCTCCTGGCCTTTGAGCTCTTCGCCGAGGAGCAAGCAGAGGGACCTGGCCGCCTGCTGTATAGAGACGGCTTCAGCACCATCCTGCACCTGCTGCTTGGGTCACCCCGCCCAGCTGCTGCGACTTTGCATGCTGAGCTGTGCCAGGCGGGATCCGACCAAGGCCTCTCCCTCTGTCAGTTCCAGGACTTCTCCCTCCGTGACCCACTCCACGGGAAGCTCTTCAGCACCTACCTGCGCCCCTCCCAGACACCAAATGCCTCATCCCCAGGCAGCCCCACTGCTCTGGCCAATGGGACTGTGCACGTGCCCAAGCAGAAGGGCGACTGAGCGCCTCCACCTCCCCAGCTCGCATCCAGCCCACAGACTCAGGGCAGCGCCAGGGGCTGACCCTGGGCCTCACGCCCTCTCTGCTCCTGCTTGATTTTTTGTTATTGTTGTTTGTTTTATTAAGTTTGTTTTATTAAGTTGATTTTCACTTTTTGTTTGATTTTTT