Transcript asmbl_10513

Sequence
Transcript Sequence for observation asmbl_10513 of TGE0044708:
AGACACTAGCGAGCGGGGAAGGAGGGGTGGAAGAGGGAGGGACGTTAAAACGGCTTCTCGACGCTGATTGGACAGCAGAGGAGCACTTCCTCGCAGCACGCGCTGAGGCGGCAGTTTGCGGGCTCCAGATACCATTCCCCGCGGTCAAGATCCCGCTTACGGGTTCTCAGATCGGCGGGCAGGGCAGCCAGGTCACCCAGCAGCCCGGCCGATCTCCCCGGGGGCGTTGGAGCCGCGCTTCCGCTCCGGCCCTCGACACCACCGGCCCCTCCGCTGGTGACGCCCCCGCAGAGGCTTCGCCGTCGCCGAGGCCTTCTCTCCGCGACTCGTCGCCGCAGGATTCTACTTTCACTGGGTTCCGCCCGCACACCGCCACCATTGACGCCATGTCGAGTTATTCTAGTGACCGAGACCGCGGCCGGGATCGAGGGTTTGGTGCACCTCGATTTGGAGGGAGTAGAACAGGACCCCTCTCTGGAAAGAAGTTTGGAAATCCTGGGGAGAAACTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCCAAATTTGAGAAGAATTTTTATCAAGAACACCCTGATTTGGCAAGGCGCACCGCACAAGAGGTAGATACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGTCCAAAACCTGTTCTGAATTTTTATGAAGCAAACTTTCCTGCGAATGTCATGGATGTGATTGCAAGGCAGAACTTTACTGAACCCACTGCTATTCAAGCTCAGGGCTGGCCAGTTGCTCTCAGTGGATTGGATATGGTTGGAGTAGCTCAGACTGGATCTGGGAAAACATTATCTTATTTGCTGCCTGCCATTGTACACATAAACCACCAGCCATTCCTAGAGAGAGGTGATGGGCCTATTTGCTTGGTGCTGGCACCAACTCGAGAACTGGCACAGCAGGTGCAGCAAGTGGCTGCTGAATATTGTCGAGCTTGTCGCTTGAAGTCTACTTGCATCTATGGTGGTGCTCCCAAAGGACCACAGATTCGTGATTTGGAAAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGGAAAACCAATCTGAGAAGAACAACTTACCTTGTCCTTGATGAAGCTGATAGGATGCTTGATATGGGATTTGAACCCCAGATAAGGAAAATTGTGGATCAAATAAGACCTGATAGGCAAACACTAATGTGGAGTGCAACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATCAATATTGGTGCACTGGAACTGAGTGCAAACCATAACATTCTTCAGATTGTGGATGTATGTCATGATGTCGAAAAGGATGAAAAGCTTATTCGTCTGATGGAAGAAATCATGAGTGAGAAGGAGAATAAAACTATTGTTTTTGTTGAAACCAAAAGAAGATGTGATGAACTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGCATCCATGGTGACAAGAGTCAGCAGGAACGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACCGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGGGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGACGATCGTCGTGACAGATACTCTGCAGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAACTATGACAGAGGCTACTCTAATCTGCTTAAGAGAGATTTTGGGGCTAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTATCTGCTGGCATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAACGGTTATGATAGCACTCAGCAATATGGAAGTAATGTTGCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACCGCAGCTGCTGCGCCTATGATTGGCTATCCCATGCCAACAGGGTATTCTCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCAGACAAGATAGTTATTTAAGAAACATGGGAAATGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAACTGTACAGTGATTTCAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAGATATTTGAAGACTGAATTAAGTGAAATTGTACTTTATTTTACATATATAATGTCATGTACAACTTGGCTTAGATAGTGTTTTTGGGGGGGATTTTTGTTTTGGTGTTTATTTTTACACAAGGAAAGTTGACTACTTCCCATTCCTGGATTTAGGAGAGGAACTCAGAAGGCCCTTAGGATGATCTGTTTGTATGGGAAGAAGTTAGAGACAATGGATTTTATAATTCCAGATTTATTGGATAAAAGCTTTGTCATTTTTCAGTATCAGGGAAGTAAGTCATTTAATAGCCTATTTTCCTTAAGAGTGAACTACAGGACAGTAACTATATAAATACATGTTGATTTCTTTTGCAAAACAGTTTTAAGTAATGACATTTTTGCTTTATCAAAATTTTATTCCATCTCTTGGTTTTGTTGTCAACTGCCGAAATGTGCGAAGCTGAAAGACTGTTAGCCCAAGAGCTGTGTGCACTGTGTCTTTAGTGCAGGATTACCTTGTAGGTTCCTAGTCCTCGAGGACTTGCCAGAGTGCTTATAGCCACACCTGGAAGTCAGGAATGTCTCCACATTATTTCAGGGGATTTTAGGGGTCTTGTAGGCTAGTCACAAGGAAGACGACATAACCAAAAGCACAGTAAAGTTTTCGGGTTAGGTTCACTATGGGCTTAACAGCTAGAAGGATTGGGGGGAAAGCTTTAGATTTAAGTAGGATCACCAGCAAACAGCTTTGTTTCAGAATGGCTATAAGTAGGTCTAAATGTCTTCCCAAAAAATTGGTGTGTTTTTTGCCCAGGACAAAAGTCTTAAAGGAAGTTATTTAACTTTTTGTTTTTAAAATGGGCTTATTGTTAATGCCTTATTTATAAAATGTTAAAACAAAATAGAATGTGCTGGGGGTGGGAGCTGGGCGTGTTTTCCAGGGCTGATAACATTGAAAACTGGTTCATCCTCTAGTACTGAGTGGTTTTCAATGGCATGGCTAGTCAGATTCATGATTTTTAAGTATAGGTGTAGATTGGAGCATTTATTACATATTTTACTGTTCAATGTCTTAATGTGGACCTTTTATTTTGTAAATAATTATGGAAATGATTGTGGGGCTTGGAAAAAATTACCTTTGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTTGTCTTAACTAATAAATGTGATTTTTCTCCC