Transcript asmbl_10707

Sequence
Transcript Sequence for observation asmbl_10707 of TGE0000007:
CACATCAGACGCATGTTGACTGAGACCTAGAGTCATGGATGTATGCGTCCGTCTTGCCCTGTGGCTCCTCTGGGGACTCCTCCTGCACCAGGGCCAGAGCCTCAGCCATAGTCACAGTGAGAAGGCGACAGGAACCAGCTCGGGGGCCAACTCTGAGGAGTCCACTGCAGCAGAGTTTTGCCGAATTGACAAGCCCCTGTGTCACAGTGAGGATGAGAAACTCAGCTTCGAGGCAGTCCGTAACATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGTGGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGGCTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCATGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCGGCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTTGACTCGCCATAATCACCTCAAGGACTTC