Transcript asmbl_10315

Sequence
Transcript Sequence for observation asmbl_10315 of TGE0035846:
GTGGCTGAAGGAGGCCGGTTTGTTTCGGAACTGAGGCTCAAGCACAGCCGCTCAGGATTGGTGCTAGGCTGGGCCGGGGTCTTTGGCCGGAAGCGGAAGTGGAGAAAGGATGCAGGACCATCAGCACGTGCCCATCGACATCCAGACCAGCAAGCTGCTCGACTGGCTGGTGGACAGAAGACACTGTAACCTAAAATGGCAGAGCCTGGTGCTGACCATCCGGGAAAAAATCAACACTGCCATCCAGGACATGCCAGAGAGCCAGGAGATTGCCCAGCTGCTCTCTGGATCCTACATTCATTACTTCCACTGCCTAAGAATAGTGGACCTTCTTAAAGGCACCGAGGCGTCCACCAAAAATATTTTTGGCCGGTACTCTTCACAACGGATGAAAGATTGGCAGGAGATCGTAAGCCTGTATGAGAAGGACAACACCTATTTAGTGGAACTCTGTAGCCTCCTGGTTCGGAATGTCAGCTATGAGATCCCCTCGCTGAAGAAGCAGATTGCCAAGTGCCAGCAACTGCAGCAAGAATACAGCCGCAAGGAGGAGGAGGGCCAGGCTGGGGCCGCTGAGATGCGAGAGCAATTCTACCACTCCTGCAAACAGTATGGCATCACGGGAGACAATGTCCGAAGAGAACTTCTGGCCCTGGTGAAGGACCTGCCAAGTCAGCTGGCTGAGATAGGGGCAGGGGCTCAGTCCCTGGGGGAGGCCATTGACCTGTACCAGGCCTGTGTGGAGTTTGTGTGTGACAGCCCCACAGAGCAAGTGCTGCCCATGCTGCGGTATGTGCAGAAGAAGGGAAACTCGACGGTGTATGAGTGGAGGACGGGGACAGAGCCCTCTGTGGTGGAGCGACCACAGCTGGAGGAGCCTCCTGAGCAGGTGCAAGAGGATGAGATCGACTGGGGTGACTTTGGGGTGGAAGCTGTTTCCGACTCTGGCATCGTTGCTGAGACTCCTGGAATAGACTGGGGTATCTCCCTGGAGTCAGAGGCCAAGGATGCTGGGGCTGACAAGATAGACTGGGGTGACGATGCTGCTGCTGCTTCAGAGATCACCGTGCTGGAGACAGGAACTGAGGCTCCGGAGGGTGTAGCTCGGGGCTCAGACGCTCTGACTCTTCTGGAATACCCTGAAACTCGGAATCAGTTCATTGATGAGCTCATGGAGCTTGAGATCTTCTTGTCTCAGAGAGCAGTAGAGATGAGCGAGGAGGCCGACATCCTGTCCGTGAGCCAGTTCCAGCTGGCTCCTGCCATCCTCCAGGGCCAGACCAAAGAGAAGATGCTCAGCCTGGTGTCCACGCTGCAGCAGCTGATCGGCCGGCTCACCAGTCTGCGGATGCAGCACCTGTTTATGATTCTGGCCTCGCCAAGGTATGTGGACCGAGTGACAGAGTTCCTCCAGCAGAAGCTGAAGCAGTCGCAGCTGTTGGCTTTGAAGAAGGAGCTGATGGTGGAGAAGCAGCAGGAGGCGCTTCAGGAGCAGGCAGCTCTGGAGCCCAAGCTGGACCTGCTGCTGGAGAAGACCAGAGAGCTGCAGAAACTGATTGAAGCCGACATCTCCAAGAGATACAGTGGCCGTCCTGTGAACCTGATGGGGACCTCTCTGTGACGCGCTCCCTCTGTGTCCTCCACCCTCCTTCCCAGCTACCAGGAGGAGGTGGGACAGCCCAGGCTGATGCTACTGGGCCTCACCAGCAAGAAGTCAGGCGGACTTGGAGACAGAGCCATGAGGAAGGGTCACACCATGATCTCTGCAAGCAGTTGTCTTGAGTGGCTCTGGCCTGTCAGCCTTAAGGCACACTTGCTGCTTCTAGTTGTCAAGTGAGGCTTAATAAAAGGAAGTGACTCTCCTTCGTGGCTGGCAGTCACTTGCACCACCACGCTGAGCCTGCTTGAAGTTGAAGCTGTGCACA