Transcript asmbl_9663

Sequence
Transcript Sequence for observation asmbl_9663 of TGE0000759:
CTCGATCTCCAGTATCTAGGATCACGATTTTTTAGGAAGAAAACAAATTAGTGTGAGATGAAATAAGGTGAAATAGCGTAGCGTAAATACAGACAATCATGGAGTGGGGCTTGGGCTCTCCCCTTCGCAGATAATGGGCGGAGCCTGCGGCCCACAAGCTCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTACAGAAGAGGCTTGCCTCTAGTGTCCTCCGCTGCGGGAAAAAGAAGGTCTGGTTGGATCCCAATGAGACCAATGAAATCGCCAATGCCAACTCCCGTCAGCAGATCAGGAAGCTGATCAAGGATGGGCTGATCATCCGCAAGCCTGTGACTGTCCATTCCCGGGCTCGTTGCCGGAAAAACACCCTGGCCCGACGGAAGGGCAGGCATATGGGCATAGGGAAGAGGAAGGGTACTGCCAATGCTCGGATGCCTGAGAAGGTGACCTGGATGAGAAGGATGAGGATCCTGCGCCGGCTTCTCAGGAGATACCGGGAATCCAAGAAGATTGACCGCCATATGTATCACAGCCTGTACCTGAAGGTCAAAGGGAATGTGTTCAAAAACAAGCGCATCCTCATGGAGCACATCCACAAGCTGAAGGCAGACAAGGCCCGCAAGAAGCTCCTGGCTGACCAGGCTGAGGCTCGCAGGTCTAAGACCAAGGAAGCACGAAAGCGCCGGGAGGAGCGCCTCCAGGCCAAGAAGGAAGAGATCATCAAGACTCTGTCCAAGGAGGAGGAGACCAAGAAATAAAGCTTCCCTCGTGTCTGTACATAGCGGCCTGGCTGTGGCCTCATGTGGATCAGTCTTTAAAATAAAACAAGCCTTTGTCTGTT