Transcript asmbl_8831

Sequence
Transcript Sequence for observation asmbl_8831 of TGE0044544:
GGAAGCAGCTCTCCAGCTGCCTTTATAGGTTTCATAAGTCTTAAGCATCAGCAGCTCATTCTTTAGATGGCAGGGGAAGCAGGCTTGGAGCAGATTGGCTCCTGGCCTGATCAGAGTTGACTGGCACCCACATGTAAGTGGTACGGGCTGTAGGCTTGTTGGCTCTGGATTAATGGAGGGAGGCTGAGTCTGAACCACTAGCCCACGACGGTGTGTGCATCTGCAGAGTGCCCACCTATTGGGATGGAGTCACACCGCATTGAGGACAACCAGATCCGTGCCTCCTCCATGCTGCGCCACGGCCTCGGAGCCCAGCGGGGCCGGCTCAACATGCAGGCTGGTGCCAATGAAGATGACTACTATGACGGGGCATGGTGTGCTGAGGACGAGTCGCAGACCCAGTGGATCGAGGTGGACACCCGAAGGACAACTCGGTTCACGGGCGTCATCACTCAGGGCCGTGACTCCAGCATCCATGACGACTTCGTGACTACCTTCTTTGTGGGCTTCAGCAATGACAGCCAGACCTGGGTGATGTACACCAATGGCTACGAGGAAATGACCTTCTATGGAAATGTGGACAAGGACACACCTGTGCTGAGCGAGCTCCCTGAGCCAGTTGTGGCCCGTTTCATCCGCATCTATCCACTCACCTGGAACGGTAGCCTGTGCATGCGCCTGGAGGTGCTAGGCTGCCCCGTGACCCCTGTCTACAGCTACTACGCACAGAATGAGGTGGTAACTACTGACAGCCTGGACTTCCGGCACCACAGCTACAAGGACATGCGCCAGCTGATGAAGGCTGTCAATGAGGAGTGCCCCACAATCACTCGCACATACAGCCTGGGCAAGAGTTCACGAGGGCTCAAGATCTACGCAATGGAAATCTCAGACAACCCTGGGGATCATGAACTGGGGGAGCCCGAGTTCCGCTACACAGCCGGGATCCACGGCAATGAGGTGCTAGGCCGAGAGCTCCTGCTCCTGCTCATGCAATACCTATGCCAGGAGTACCGCGATGGGAACCCGAGAGTGCGCAACCTGGTGCAGGACACACGCATCCACCTGGTGCCCTCGCTGAACCCTGATGGCTATGAGGTGGCAGCGCAGATGGGCTCAGAGTTTGGGAACTGGGCACTGGGGCTGTGGACTGAGGAGGGCTTTGACATCTTCGAGGACTTCCCAGATCTCAACTCTGTGCTCTGGGCAGCTGAGGAGAAGAAATGGGTCCCCTACAGGGTCCCAAACAATAACTTGCCAATCCCTGAACGTTACCTGTCCCCAGATGCCACGGTCTCCACAGAAGTCCGGGCCATTATTTCCTGGATGGAGAAGAACCCCTTTGTGCTGGGTGCAAATCTGAACGGTGGTGAGCGGCTTGTGTCTTATCCCTATGACATGGCCCGGACACCTAGCCAGGAGCAGCTGTTGGCCGAGGCACTGGCAGCTGCCCGCGGAGAAGATGATGACGGGGTGTCTGAGGCCCAGGAGACTCCAGATCACGCTATTTTCCGCTGGCTGGCCATCTCATTTGCCTCCGCCCATCTCACCATGACGGAGCCCTACCGGGGAGGGTGCCAGGCCCAGGACTACACCAGCGGCATGGGCATTGTCAACGGGGCCAAGTGGAATCCTCGCTCTGGGACTTTCAATGACTTTAGCTACCTGCACACAAACTGTCTGGAGCTCTCCGTATACCTGGGCTGTGACAAGTTCCCCCACGAGAGTGAGCTACCCCGAGAATGGGAGAACAACAAAGAAGCGCTGCTCACCTTCATGGAGCAGGTGCACCGTGGCATTAAGGGTGTGGTGACAGATGAGCAAGGCATCCCCATTGCCAATGCCACCATCTCTGTGAGTGGCATCAACCATGGTGTGAAGACAGCAAGTGGAGGTGACTACTGGCGCATTCTGAACCCGGGTGAGTACCGTGTGACAGCTCACGCAGAGGGCTACACCTCAAGTGCCAAGATCTGCAATGTGGACTACGATATTGGGGCCACTCAGTGCAACTTCATCCTGGCTCGATCCAACTGGAAGCGCATTCGGGAGATCTTGGCTATGAACGGGAACCGTCCCATTCTCCGAGTTGACCCCTCACGACCCATGACCCCCCAGCAGCGGCGCATGCAGCAGCGCCGTCTACAGTACCGGCTCCGCATGAGGGAACAGATGCGACTGCGTCGCCTCAATTCTACCGCAGGCCCTGCCACAAGCCCCACTCCTGCCCTTATGCCTCCCCCTTCCCCTACACCAGCCATTACCTTGAGGCCCTGGGAAGTTCTACCCACTACCACTGCAGGCTGGGAGGAGTCAGAGACTGAGACCTATACAGAAGTAGTGACAGAGTTTGAGACAGAGTATGGGACTGACCTAGAGGTGGAAGAGATAGAGGAGGAGGAGGAGGAGGAGGA