Transcript asmbl_57737

Sequence
Transcript Sequence for observation asmbl_57737 of TGE0003118:
AGCAACCCAGGCTCCAGCGCGCGCGCAGCCTCCGACCCTAATTTCTTCGTTCGCCGGAAGAAGGCGAGTCTCTTTCCGTTCCTAGCGCAGCCATGGCTCGTGGTCCCAAGAAACACCTGAAGCGTGTAGCTGCTCCAAAACATTGGATGCTGGATAAGTTGACTGGCGTGTTTGCTCCTCGTCCATCCACTGGTCCTCACAAGCTGAGGGAATGCCTGCCTCTCATCATTTTCCTAAGGAACAGACTTAAGTATGCCCTGACTGGAGATGAAGTAAAAAAGATTTGCATGCAGCGATTCATTAAGATTGATGGGAAAGTCAGGACCGATATAACCTACCCTGCTGGGTTTATGGATGTCATCAGCATTGACAAGACCGGAGAGAACTTCCGTCTGATCTATGACACCAAGGGTCGCTTTGCTGTTCATCGTATTACACCGGAGGAGGCCAAGTACAAGTTGTGCAAAGTGAGAAAGATCTTTGTAGGCACAAAAGGAATCCCGCACCTGGTGACCCATGATGCTCGTACTATTCGGTACCCTGATCCCCTCATCAAGGTGAACGACACCATTCAGATTGATTTGGAGACAGGCAAAATAACTGACTTCATCAAGTTTGACACTGGGAACCTGTGTATGGTGACTGGAGGTGCTAACTTGGGAAGAATTGGTGTAATCACCAACAGAGAGAGACATCCCGGCTCTTTTGATGTGGTTCATGTGAAAGATGCCAATGGCAACAGCTTTGCCACTCGGCTGTCCAACATTTTTGTTATTGGCAAGGGTAACAAACCATGGATCTCTCTTCCCAGAGGAAAAGGAATCCGCCTCACCATTGCTGAAGAGAGAGACAAGAGGCTTGCGGCCAAACAGAGCAGTGGGTGAAATGGTCTCTAGGAGACATGCTGGAAAAGTGTTTGTACAAGCCTTTCTAGGCAACATACATGCTAGATTAAACAGCATGGTGAAACTA