Transcript asmbl_55880

Sequence
Transcript Sequence for observation asmbl_55880 of TGE0006378:
GCCCCTTCCCCGCAGGCGGGCGCTGATTGGCCCGTTTGAAATGCGCCAGGCGCGAGCTCACCTGGGCTCGCAGCCGTGCGGCGGGGCTTGACGGAGCAAAGCGTCTCAGCCGTAGCTTCCAGTTTCGTGCGGCTCGTTTCTGCGACCCGCTGTCCTCGCCAGCCCTTCCAGCGAGCTTGGCGTCCCGCGCGCGCGTCTAGGCATCACGGAGCCTGCTGCCATGAAGCCAGCGAGGACTAAGACACCCAGGAAACCTGTAGTGAAAAAAGGATCCCAAACAAGTCTTAAAGACCCAGTTGGGGTATACTGTAGGGTGCGCCCACTGAGCTTTCCTGATCACGAGTGTTGCATAGAAGTGATCAATAATACAACTGTTCAGCTTCATACTCCTGAGGGTTACAGACTCAACCGAAATGGAGACTATAAGGAGACTCAGTATTCATTTAAACAAGTATTTGGCACTCATACTACCCAGAAGGAGCTCTTCGATGTTGTGGCTAATCCCTTGGTAGATGACCTTATTCATGGCAAGAATGGTCTCCTTTTTACATATGGTGTGACGGGAAGTGGGAAAACTCACACCATGACTGGTTCTCCAGGGGAAGGAGGGCTACTTCCTCGTTGTTTGGGCATGATCTTTAACAGTATCGGGTCATTTCAAGCTAAACGATATGTTTTTAAGTGTAATGATAGGAATAGCATGGATATACAGTGTGAAGTTGATGCCTTATTAGAACGGCAGAAAAGAGAAGCCATGCCGCATCCAAAGACCCCTGCTATCAAACGACAAGCAGACCCAGAGTTTGCAGATATGATAAATTTACAAGAATTTTGCAAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTGAAATATATAATAATTACATATATGATCTATTGGAAGAAGTTTCGTTTGATCCCATAAAGCCAAAGTGGAACAGTTGCAGCACGCCCATGAGGAACACAGACTTTGTACCTCCGCAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATGTATGTTGCAGGATGTACAGAAGTAGAAGTAAAATCTGTTGAGGAGGCTTTTGAAGTTTTCTGGAGAGGCCAGAAAAAGAGACGTATTGCTAACACACATTTGAATCGTGAGTCTAGCCGTTCTCATAGCGTGTTCAACATTAAATTAGTTCAAGCTCCACTGGATGCAGATGGGGATAATGTCTTACAGGAAAAAGAACAAATCACTATAAGCCAATTGTCCTTGGTAGATCTTGCTGGAAGTGAAAGAACTAACCGGACAAAAGCAGAAGGGAACAGATTACGTGAAGCTGGTAACATTAACCAGTCACTAATGACACTAAGAACATGTATGGAAGTCCTGAGAGAGAACCAAATGTATGGAACTAACAAGATGGTTCCATATCGCGATTCAAAGTTAACTCATCTATTTAAGAACTACTTTGATGGAGAAGGAAAAGTACGCATGATTGTGTGTGTGAATCCAAAGGCCGAAGATTATGAAGAAAGCTTGCAAGTCATGAGATTTGCGGAAGTGACCCAAGAAGTTGAAGTAGCAAGACCTGTAGACAAGGCAATATGTGGTTTAACGCCTGGACGGCGATTCAGGAATCATGCTCGGGCAGGTCCAGTTGAACTACTGGTTACAGAAGTGGTTTTACAGAGTTTTCCACCTTTGCCATCCTGTGAAATTTTGGATATCAATGATGAGCAGACTCTCCCGAGGCTGATTGAAGCTTTAGAGAAACGCCATCAACTACGACAAATGATGACTGATGAGTTTAACAAACAATCTGTTACTTTTAAAGCTATGTTGCAAGAATTTGACAATGGTGTTTTAAATAAAGAAAACTACATTCAAGGAAAACTAAATGAAAAAGAAAAGGTGATCTCAGGACAGAAATTGGAAATAGAACGACTGGAGAAGAAAAACAAAACTTTAGAATATAAGATTGAAATTTTAGAGAAAACAACTACTATCTATGAAGAAGATAAGCGCAATCTGCAGCAGGAACTTGAAACCCAGAATCAGAAACTTCAGCGACAGTTTTCTGACAAACGCAGACTAGAAGCCAGGTTACAAGGCATGGTGACAGAAACAACAATGAAATGGGAGAAAGAATGCGAGCGTCGAGTGGCAGCTAAACAGCTGGAGATGCAAAATAAACTCTGGGTGAAAGATGAAAAACTGAAACAACTAAAGGCTATTGTTACTGAACCCAAAACTGAAAAGCCAGAGAGACCCTCTCGGGCACGAGATCAAGAAAAAGCTCCTCAAAGATCTGTTTCTCCATCGCCAGTACCCCTTTCTAGTAACTATATTGCTCAGATTTCCAACGGCCAGCAACTCATGAGCCAGCCACAACTACATAGGCGCTCTAACTCTTGCAGCAGCATTTCTGTAGCTTCCTGTATTTCGGAGTGGGAGCAGAAAATTCCTCCGTACAACACACCTCTCAATGTCACATCCATTGCAAGGCGTAGGCAGCAGGAGCCAGGACAAAGTAAAACTTGTATCGTGTCAGACAGAAGGCGAGGGATGTACTGGACTGAAGGCAGGGAGGTGGTTCCTACATTCAGAAATGAGATAGAAATAGAAGAGGATCATTGCTGCAGGAATGTACCACCACTTCGTCTCCGACACAGACGATCACGCTCTGCAGGAGACAGATGGGTAGATCATAAGCCTGCCTCTAACGTGCAAACTGAAACAGTCATGCAGCCACATGTCCCTCATGCCATCACAGTATCTGTTGCAAATGAAAAGGCACTAGCTAAGTGTGAGAAGTACATGCTGACCCACCAGGAACTAGCCTCCGATGGGGAGATTGAAACTAAACTAATTAAGGGTGACGTTTATAAAACAAGGGGTGGTGGACAATCTGTTCAGTTTACTGATATTGAGACTTTGAAGCAAGAATCACCAACTGGTCGAAAACGGAGATCTTCCACAGTAACACCTGCCCAACCAGATGGTGCAGAGTCTGAATGGACCGATGTAGAAACAAGGTGTTCTGTGGCTGTAGAGATGAGAGCAGGGTCTCAACTGGGTCCTGGATATCAGCATCACGCACAACCCAAGCGCAAGAAGCCATGAACTGACAGTCTAATTAATGAAAGAACATTTTGTGTCAGTAATTTCTTCAAGACCATGCCAGAAGGAGTCTTCTGAGTCATCTTGTAGAAGTCCAACTTTGACTATCACAGACCTCAGATACATCATACACTGGCCTAGATCAGAGATTTCTGTCTGGTTCCAAAGACATCTAGGATTCAACAAACTTTTTATATCCCTTGCCATATTTAATATTAATAGAGAAAGACCCCCCTTTTCTCATTGCTGCATGAACTTTTTAATAATGCTATTTTTGTATATTTGTATACTTATAAACTAATTCATGCAAGTGTTTGTCTTGGGTGATTAAGGAAGAATATATCTAGATCACGCTTTATTTTTTATTGTGACTTTTCCAGCTCTTGTCTGAATATTAAGGTTTTATAAACAAAACAAATGCTGCTATTGATTAGCTGCAAGAATGCACTTTAGACATATTTGACAATTCAAACTTTCAAAATAAAGATGTCAATGACTGGCCAATACTAAAACCATTTTAAGAAGTCGTTTTGAATTTTGTATGTATATATTCACTTTCTGACACTTAGATATACCAAAAGAATTGAAATAAAAAGCACTAAGAAAT