Transcript asmbl_55851

Sequence
Transcript Sequence for observation asmbl_55851 of TGE0006374:
GGTTTTATAGGATCACATTAACAAAAACATGATGGAGTTTTATGAGTCAACATATTTTATTGTCCTTATTCCTTCAGTAGTGATTACAGTAATTTTCCTCTTCTTCTGGCTTTTCATGAAAGAAACATTATATGATGAGGTTCTTGCAAAACAGAAAAGAGAACAAAAGCTTATTCCTACCAAAACAGATAAAAAGAAGGCAGAAAAGAAAAAGAATAAAAAGAAAGAAATCCAGAATGGTAACCTCCATGAATCTGATTCTGAGAATGTACCCCGGGAATTTAAATTATCTGATGCATTGGCTGTAGAAGATGAGCAAGTTGTACCTGTTCCACTGAATGTGGTTGATACTTCAAGTAGTGTTAGAGAAAGAAAGAAGAAGGAAAAGAAACACAAGCCTGTACTAGAAGAGCAGGTCACCAAAGAAAGTGATGTATCAAAGATTCCAGGCAAAAAAGTAGAACCTGTCCCAGTTACTAAACAGCCTACCCCGCCGTCAGAAGCAGCTGCCTCAAAGAAGAAACCAGGGCAGAAGAAGTCTAAAAATGGAAACGATGATCAGGATAAAAAGGTGGAAACTCTTATGGCACCTTCAAGAAAGCAAGAATCATTACCCCTCCACCAAGAGACTAAACAAGAAAGTGGATCAGGAAAGAAGAAAGTTTCATCAAAGAAGCAAAAGACAGAAAATGTCTTGGTAGACGAACCCCTTATTCATGCAACTACTTACATTCCTTTGATGGATAATGCTGACTCAAATCCCGTGGTGGATAAGAGAGAGGTTATTGATCTAATTAAATCTGACCAAGTAGAAGCAATTCAGAAAACAGGGGCTAAAAAACTGAAGACTGAAACTGACAAAGAAAATGCTGAGGTGAAATTTAAAGATTTTCTTCTGTCCTTGAAGACTATGATGTTTTCTGAAGATGAGGCCCTTTGTGTTGTAGACCTGCTAAAAGAGAAGTCTGGTGTGATACAGGATGCTTTAAAGAAGTCAAGTAAAGGAGAATTGACTGCACTTTTACATCAGCTTCAAGAAAAAGACAAATTACTTGCTGCTCTGAAGGAAGACGGCACTGCTATGAAGGATCGGTGTAAGCAGCTAACCCAGGAAATGATGACAGAGAAAGAAAGAAGCAATGTGGTTATAGCAAGGATGAAAGATCGGATTGGTGCATTAGAAAAGGAACATAATGTATTTCAAAACAAAATTCATGTCAGTTATCAAGAGACTCAACAGATGCAGATGAAGTTCCAGCAAGTTCGTGAGCAGATGGAGGCAGAGATAGCTCACTTGAAGCAAGAAAATGGCATACTGAGAGATGCTGTCAGCAACACTACAAACCAACTAGAAAACAAGCAGTCTGCTGAACTAAATAAACTGCGCCAGGATTATGCCAGATTGGTGAATGAGCTGACTGAGAAAACAGGAAAGCTACAGCAAGAGGAAGTCCAAAAGAAGAATGCTGAGCAAGCAGTTACTCAGTTGAAGGTTCAACTACAAGAAGCTGAGAGAAGGTGGGAAGAAGTCCAGAGCTATATCAGGAAGAGGACAGCAGAGCATGAGGCAGCACAGCAAGATTTACAGAGTAAATTTGTGGCCAAAGAAAATGAAGTACAGAGTCTGCATAGTAAGCTTACAGATACCTTGGTATCAAAACAACAGTTGGAACAAAGACTAATGCAGTTAATGGAATCGGAGCAAAAAAGGGTGAACAAAGAAGAGTCTCTACAAATGCAACTTCAGGATATTTTGGAGCAGAATGAGGCTTTGAAAGCTCAAATTCAGCAATTCCATTCCCAGATTGCAGCTCAGACCTCTGCTTCAGTTCTAGCAGAAGAATTACATAAAGTGATTGCAGAAAAGGATAAGCAGATAAAACAGACTGAAGATTCTTTAGCAAATGAACATGATCATTTAACAAGTAAAGAGGAGGAACTTAAGGATATACAGAATATGAATTTCTTATTAAAAGCTGAAGTGCAAAAATTACAGGCCCTGGCAAATGAACAGGCTGCTGCTGTACATGAACTGGAGAAGATGCAAAAAAGTATTCATGTTAAGGATGATAAAATAAGATTGCTTGAAGAGCAGCTACAGTGTGAAATTTCAGACAAAATGGAAGAATTTAAGATTCTAAATGACCAAAACAAAGCATTACAATTAGAAGTTCAGAAGCTACAGACTCTTATTTCTGAACAGCCTAATAAAGATGTTGTGGAACAAATGGAAAAATGCATTCAAGAAAAAGATGAGAAGTTGAAGACTGTGGAAGAATTGCTTGAAACTGGGCTTATTCAGGTGGCCACTAAAGAAGAAGAACTGAATGCAATAAGAACAGAAAATTCATCTCTGACGAAAGAAGTTCAAGACTTAAAGGCTAAGCAGAATGATCAGGTTTCTTTTGCATCTCTAGTTGAAGAACTTAAGAAAGTGATCCATGAAAAAGATGGAAAGATCAAGTCTGTGGAAGAGCTTCTGGAAGCTGAACTTCTCAAAGTTGCTAATAAGGAGAAGACTATTCAGGATTTGAAACAGGAAATAGAGGCTCTAAAAGAAGAAATAGGAAATATCCAGCTTGAAAAGGCTCAACAGTTATCTATCACTTCTCAAGTTCAGGAGCTTCAGAACTTGTTAAAAGGAAAGGAGGAACAGATAAATACCATGAAGACTGCTTTAGAAGAGAAGGAGAAAGATCTAACTAATAGAGGGAAATGGTTACAGGATCTTCAAGAAGAAAATGAATCTTTAAAAGATCATGTTCAGGAGATAGCACAACATAACTTGAAAGAGGCATGTTCTGCATCACGATTTGAAGAACTTGAGACTGTGTTGAAAGAAAAGGAAAATGAAATGAAGAGAGTAGAAACTATGCTGAAGGAGAGGGAGAGTGATCTTTCTAGCAAAACAAAGCAGTTACAGGAGGTACAAGATGAAAACAGATTGTTTAAATCCCAAATCGAGCAGCTTAAGCAACAGAACTACCAACAGGCATCTTCTTTTTCCCCTCATGAAGAACTATTGAAAGTAATTTCAGAAAGAGAGAAGGAAATAACTTGTCTCCAGAATGAGTTAGATTCTTTGAAGGATGCGGTTGAACACCAGAGGAAGAAAAATAATGACCTTCGGGAGAAAAACTGGGAAGCAATGGAAGCATTGGCATCAACTGAAAAAATGCTGCAGGAGAGAGTGAACAAGACTTCCAAGGAAAGACAACAACATGTGGAAACTGTTGAGTTGGAGGCTAAGGAAGTTCTCAAAAAATTATTTCCAAAGGTGTCTGTCCCTTCTAATTTGAGTTACAGCGAATGGTTACGTGGATTTGAAAAGAAGGCAAAAGAATGTGTGACTGAAACTTCAGGTTCAGAGGAGGTTAAGGTTCTAGAGCACAAATTAAAAGAAGCTGATGAAATGCACACATTGTTACAGCTGGAGTGTGAAAAATATAAGTCCGTCCTTGCAGAAACAGAAGGAATTTTACAGAAGCTACAGAGAAGTGTGGAACAAGAAGAAAATAAATGGAAAGTTAAGGTCGATGAATCACAAAAGACTATTAAACAGATGCAGTTGTCATTCACATCTTCGGAACAAGAGCTAGAGCGATTAAGAAAAGAAAATAAAGATATTGAAAATTTGAGACGAGAACGAGAGCATTTGGAAATGGAACTAGAGAAGGCAGAAATTGAACGATCTACCTATGTCACAGAAGTCAGAGAGCTGAAAGATCTGTTGACTGAATTGCAGAAAAAACTTGATGATTCATATTCTGAAGCAGTAAGACAGAATGAAGAGCTAAATTTGTTAAAAACACAATTAAATGAAACACTCACAAAACTTCGAACTGAACAAAGTGAAAGACAGAAGGTAGCTGGTGACTTGCATAAGGCTCAACAGTCACTGGATCTTATCCAGTCAAAAATAGTAAAAGCTGCTGGAGATACTACTGTTATTGAAAATAGTGATGTTTCCTCAGAAATGGAATCTTCTGAGAAGGAGACAATGTCTGTAAGTCTAAATCAGACTGTAACACAGTTACAGCAGTTGCTTCAGGCAGTAAACCAACAACTCACAAAAGAGAAAGAACACTACCAGGTCTTAGAGTGAAGTAATTGGGGAAACCATTCAAGGATAACAGGAGGCATTGTATTATATTTTGCCAAATTAAAGCCTTATTTATGTTTTCACCCTTTCTACTTCGTCAGAAACACTGAACAGAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGATTTAAAGAGAGAGAAAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAAACTGTTTGAATAATTAGACCTTTACATTCCTGAAGATAAAATAAACATGTACTCTTTTATCTTATTTTGCTCAATAAAATTGTTCAGAAGATCAAAAGTGGTAAAGACAATGTAAAATTTAACATTTTAATACTGATGTTCTACACTGTTTTACTTAACATTTTGGGGAGTAACTGCCTCTGACTTCAACTCAAGAAAACACTTTTTTGTTGCTAATGTAATCAGTTTTTGTAATGGCGTCAGCAAATAAAGGGATGCTTATTATTCA