Transcript asmbl_56487

Sequence
Transcript Sequence for observation asmbl_56487 of TGE0044338:
ACCTCCGTTCCTCAGGCCCCGGTGCCGGCCTCCCTGTTTCCTGTCGGATCCGCCGCCACCATGGCAGAGTTGGGCCTAAATGAGCACCATCAAAATGAGGTCATTAATTACATGCGTTTTGCTCGTTCAAAAAGAGGCTTGAGACTTAAAACGGTAGATTCCTGCTTTCAGGACCTCAAGGACAGCAGGCTGGTGGAGGAGACTTTCACCATTGATGAGGTTTCAGAAGTCCTAAATGGGCTGCAGGCTGTGGTACACAGTGAGGTGGAGTCCGAGCTCATCAATACAGCTTACACCAATGTCCTGCTCCTACGGCAGCTGTTCTCCCAAGCTGAGAAGTGGTATCTAAAGCTACAGACAGACATCTCTGAACTTGAAAACAGAGAATTATTAGAACAAGTTGCTGAATTTGAAAAGGCAGAATTTGTATCTTCAAGTAAAAAGCCCATCATAGATATCACAAAGCCTAAACTTGTTCCAATTAATGAAGGTGGAACTACAGAGCTCCTAAACAAGGAAATTTTAAGACTTCAACAAGAGAATGAAAAACTAAAGTCAAGGCTGAAGACCATTGAAATACAGGCTGTAAATGCTCTGGATGAGAAGTCAAAATTGGAAAGAGTACTTCAAGATTTACAGCTCGATCAAGAAAACCAACAGGATTTGCTAAAGGCCCAAGACTTGGATGACTTGGAAAATACAGTTGCAACTCTTAGGAGTGAATTTCAGAAGACACTTAATGACAAGACAGAAAACCAAAAATCTTTGGAAGAGAACCTAGCAGCAGCCAAACATGACCTCCTCAGAGTACAGGAGCAGCTGAGCATGGCTGAAAAGGAGTTAGAGAAGAAATTTCAACAAACAGCAGCTTATCGAAACATGAAAGAGATTCTCACCAAAAAGAATGATCAAATCAAAGACCTACGGAAAAGACTGGCAAAATATGAATCTGAAGATTAAAGACTGGAGATTTTGTCTAGAACCTGCCACACATGAACATACAAGCTATCTCCATTCACCTCAGGCATGTATTTAGAAGCATTTTGTCATATTCTGTTCTTTTTCCAATGTTTAGGCTTTCCTTGTAATATTAGAACTATCATTCTTATCTTCAGTTCTGTAATTGCGAAGAGAAAAAAAATGTAATGATTCTTTTCTATTGTCCCAAATACGCCTCTGTCATATGCTCCAGAGCCTCCATGCAAGTACAGTGAGATTTCTTCATGGTAGACAGCAGTTTAGAGTGGGAAGAAGAGCCATCCTTTTGCGTTAGTGAGTGAACTTTTTAATGTTAGAGAAGCTGGTAACATCTATACTTGTA