Transcript asmbl_54327

Sequence
Transcript Sequence for observation asmbl_54327 of TGE0006305:
AGGTTATCCTGAATACCACATGTCTAATACTTTCCCTTGCAACGTTAGCCAGTGTTTTTCACTGCCTCCAAAAGATTGAAATTGCTCTGGAAATTGGAAACATTTGATTTAAACGAAATAACGTTAACAAATGGACAATATGTCTATTACAAATACACCAACAAGTAATGATGCCTGTCTGAGCATTGTACATAGTTTGATGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTGAAGAAACTGAAGGAGAAAAAGGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGCAAATGTGTTACCATACAGAGAACATTGGATGGAAGGCTTCAGGTTGCCGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGACAGTGTCTGTGTGAATCCATATCACTATGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCACCAAGTATGTTGGTGAAGGATGAATATGTTCATGACTTCGAGGGACAGCCATCGTTATCCACCGAAGGGCATTCAATTCAAACCATCCAACATCCACCAAGTAATCGTGCATCAACAGAGACATACAGCACCCCAGCTCTCTTAGCTCCATCTGAGTCTAATGCTACCAGCACCACCAACTTTCCCAACATTCCTGTGGCTTCCACAAGTCAGCCTGCCAGTATACTGGCAGGCAGCCATAGTGAAGGATTGTTGCAGATAGCTTCAGGGCCTCAGCCAGGACAGCAGCAGAATGGATTTACTGGTCAGCCAGCTACTTATCATCATAACAGCACTACCACCTGGACTGGAAGTAGGACTGCACCATACACACCTAATTTGCCTCACCACCAAAACGGCCATCTTCAGCACCACCCGCCTATGCCGCCCCATCCCGGACATTACTGGCCAGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCTAATCATCCTGCTCCTGAGTATTGGTGTTCCATCGCTTACTTTGAAATGGATGTTCAAGTAGGAGAGACATTTAAGGTTCCTTCAAGCTGCCCTATTGTTACTGTTGATGGATACGTGGACCCTTCTGGAGGAGATCGCTTTTGCTTGGGTCAACTCTCCAATGTCCACAGGACAGAAGCCATTGAGAGAGCAAGGTTGCACATAGGCAAAGGTGTGCAGTTGGAATGTAAAGGGGAAGGTGATGTTTGGGTTAGGTGCCTTAGCGACCATGCAGTCTTTGTACAGAGTTACTACTTAGACAGAGAAGCTGGGCGTGCACCTGGAGATGCTGTTCATAAGATCTACCCAAGTGCATATATAAAGGTCTTTGATTTGCGACAGTGTCATCGGCAGATGCAGCAGCAGGCGGCCACTGCACAAGCTGCAGCAGCTGCCCAGGCAGCAGCCGTGGCTGGAAACATCCCTGGCCCAGGATCAGTAGGTGGAATAGCTCCAGCTATCAGTTTGTCAGCTGCTGCTGGAATCGGTGTTGATGACCTTCGTCGCTTATGCATACTCAGGATGAGTTTTGTGAAGGGCTGGGGACCGGATTACCCAAGACAGAGCATCAAAGAAACGCCTTGCTGGATTGAGATTCACTTACACCGGGCTCTCCAGCTCCTAGATGAAGTTCTTCACACCATGCCTATTGCGGACCCACAACCTTTAGACTGAGGTCTTTTACTGTTGGGGCCCATAACATTCTTTGTCAGGATGGTGGACTATAAAATACAATCCTGTTTATAATCTGAAGATATATTTCACTTTCGTTCTGCTTTATCTTTTCATAAAGGGTTGAAAAATATGTTTGCTGCCTTGCTCCTAGCAGACAGAAACTGGATTGAATCAATTTTTTTTCCTATTTAGAACTTTTCAGGCATGGCTCAGAGCTTGAAGATCAGGAAAAACACATTCTTATTAAATCTTCACCAGTTATATATGAAGGAATCATTCCAATGCTGGAAAATTTAGCCCTTTAAACTGTCTTAGACCCTTTTATATGCAGAACATCGATATGTGTGTTATTCTACAGAATAAATTCAATATTGCTGATTTTAAAGGCAGAGAAGCTCTCTAAGTTAATTCACCTATGTTATTTTGTGTGCGAGTTGTTATTGTTGAACATACTTTACTCCCAGGTATTGTGCCATGTGGGTGAGTTAATTTTACCAAGAGCAACTTTACTCTGTGTTTAAAAAATAAGATAGTAATGTATTATAACCTTTTATCCAAAATATTTTTTGCAAGTTAAACTAGTGAAGATGATTTCAATTCAGATTGTCTTACGATTTCAATTTTATTTTCGCCAAGGCAAAACACTAATCTCTGTGTATACTGAGAATTCTTTAAAATTATCAAAGTAATATCATTTAAAATTACACTCGTTATCCCTGTTGGATAACTATTTATCAAGTAGTGTACTTTTGCCCTGTTAAACAGTAGACGTAGTATATATTTCTAGGCACAAGGTTGGTTACTAAGCAGCCTAGAAGAAGAATTTCTTTTTCTTCATTAATTCATAGGGAAAGGTTTTGTATTTTTAAAAACACTAAAAGCAGTGTCACTCCACCTGATAACTTACCATTCTGCAAAGGTGGCAATGCTTAAACTAAATGATGAGTATTTTGGAAACTGCTAAATTCTGTGTTAAATACTGTGCAGAATAATGGAAACATTATAGTTCATAATAGGTAGTTTGGATATTTTTGTACTTAATTTGATGTGTGACTTTTTTTTCATATACTGTTTAAATCATGTATGTTATGACATTGTTTAAAATTCAGTTTTTGTATCTCGGGGCAAGACTGCAAACTTTTTATACCTTTTGGTTATTCTAAGCCCTTTGCCATCAATGATCATATCAATTGGCAGTGACTTTGTATAGAGAATTTAAGTAGAAAAGTTGCAAATGTATTGACTGTACCACAGACACAATATGTATGCTTTTTACTTAGCTAGTAGCATAAATAAAACCAAATCTCAACATAAAAAGTTGAATTCTAGGTTTGATTTTTAAGTTTTTTTTCTTTTGCACTTTTGAGTCCAATCTCAGTGGCAGGACACCTTCTACTAAATGACAGGCAACAGCCAGTACTGCAGCTTTGGTTTTTCCCTTACACTCTACTGGGACTTCCCCATGGACATTATATATCAAGTAAAGAATTGGTTATTTTTTGAACTTTTATTTTACTGTAGCAAAAATAGTCCTGATTGTCTACAAGATAAATAAGTTGTCTACAAGATAAGTAGTTTGAAATAAGATCAAGGATTATCTTTCAGATGCTTTTACTGTTTGTTTGGAAGGCCTTTCTAAGTGTAGTAAGATTCTAAGGTGTGTTACAAGTTTGAGATAATGAGAAGCACTTATGCATGATAGTCATCCTTATATCGACTTAGGTGAACAAGTCTTCAACTTCCTTGCTCTGAAAGTCTTAAGACCACCTAGTAACCACTGAGTTTGCTTATTGCTGTGATTTAAACATAGTTGTTGATTCAAGCTACATGTTTTTTGTTTTTAAAATAACTTCTTTACCAACTCATTTGTACTCTTGAGTACTTACAGATACCTTTGTTAAAAACCTCATTTTAATCTGTAAAAGTATGGTGATTTAAGTTTAATTGGCAGATTTTTTAAAAAGATA