Transcript asmbl_53839

Sequence
Transcript Sequence for observation asmbl_53839 of TGE0006294:
CAGAAGGCGGGGGAGAGGGCGGGCGGGGGGTCTACGGCCGCATGCCGCTACGGAGCAGCCAGGCTAAGGAAACTAACTAAAACCACGGCGTATTCGTCGGCCCCAGCCTGGCTCCCGGAAGCACACGGCGGGCTTTGCTCTAGCCTCAGCGAGAACGCCGGCCGCATCCCCCTGTCCGGAGTTGGATCCCGCCGCGCTTCCGGTGTGTTTTCCGGTCCGCCTCCCCAGGCAGGAAGTGCCGGGCGCGGCCTCTGTCGCGCCTCAGTCCATCGCTCATCGCAGTCGCTCGTCGTCTCGTGCAGGGCACCGCGGGTTCTGGTGTTGGCGACGAATTAAACAGCCACCATGTCAAGCAAAAAGGCAAAGACCAAGACCACCAAGAAGCGCCCCCAGCGTGCAACATCCAATGTGTTCGCCATGTTTGACCAGTCACAAATTCAGGAGTTCAAAGAGGCCTTCAACATGATTGATCAGAATAGAGATGGCTTCATTGACAAGGAGGATTTGCATGATATGCTTGCTTCTCTAGGGAAGAATCCAACGGACGCATACCTCGACGCCATGATGAATGAGGCTCCAGGGCCTATAAATTTCACCATGTTCCTCACGATGTTTGGTGAAAAGTTAAATGGCACAGATCCAGAAGATGTCATCAGAAATGCTTTTGCTTGCTTTGATGAAGAAGCAACTGGCACCATTCAGGAAGATTACCTGAGAGAGCTGCTGACGACAATGGGAGATCGGTTTACGGATGAGGAAGTGGATGAGCTGTACAGAGAAGCACCTATTGACAAAAAGGGAAATTTCAATTACATTGAGTTCACGCGCATCCTTAAACATGGAGCAAAAGATAAAGATGATTGAAAGAACTTTAGCTAAAACCTTTCGATTTCTTTGTCTTACTCTGTTTTATTTCCCCAGCACTTTCCCCAACATTTATCGACCTGTTGCATGCAACTTAGTTTCACAGCTTTGCCTCTTTTTTTTGATGTATTTATTCTAGACCTTTCTGCCAATTAGCACTTGTATAATCAGACTACAGATGGGGATGAGGTTGTAAATTGAAAAAGATTGCGAATAAAAATCAACAAATGTGAAAGCCCAGGAAAATATATTTGGTATTTCTGGTTTTGCTGGATTTTTACATTTTTATATAATAAAAATGCTATTTTGAAATCAAAA