Transcript asmbl_44419

Sequence
Transcript Sequence for observation asmbl_44419 of TGE0001880:
GGTGGCGGAAGTGGAAGCAAGGCCGGAGCTTTGACCATAAAGCCCAAGGCGGCGGCGTTGGCGGCGGTGTTTGGGGCCGGGCAGCTCCGAGGAGCCTGCTGGAGCCGGAATCGGACGTCTCTGTTGCGGCCTGCGTTGTGTCTCCTCCTCCGTTGACCCTGCGCTTCAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTCATCATCCTGGGGGACTCTGGTGTTGGAAAGACCTCTCTCATGAACCAGTATGTGAACAAGAAGTTCAGTAACCAGTACAAAGCCACAATAGGAGCGGACTTTCTGACCAAGGAGGTGATGGTGGACGACAGACTTGTTACCATGCAGATCTGGGACACAGCCGGTCAAGAACGGTTCCAGTCTCTTGGTGTGGCCTTCTACAGAGGTGCAGATTGCTGTGTTCTGGTGTTTGATGTGACTGCCCCCAACACTTTCAAAACCCTCGACAGCTGGAGAGACGAGTTTCTCATCCAGGCCAGCCCCCGGGATCCCGAGAACTTCCCTTTTGTTGTGTTGGGAAACAAGATTGACCTGGAAAACAGACAAGTGGCCACAAAGAGGGCACAGGCTTGGTGCTACAGCAAAAACAACATTCCTTACTTCGAGACCAGTGCCAAGGAGGCCATCAATGTGGAGCAGGCCTTCCAGACAATTGCTCGGAATGCCCTTAAACAGGAAACAGAAGTGGAACTGTACAATGAATTCCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCCGCAGAAAGCTGCAGTTGTTGAAGGGGCAGTGAGCACAGAGTCCTTCACAGACCAAGAACACACACGTAGGCCTTCAATATGCGTCCCTCCTCCTCCAAACAGACCAGAACGTGAGCTCTCACATCCAGCTGCCAAAAGAAACTCCACCGAACAGTTACCCAACACACACACATACACAAAACACACTCGTGCACACAAAAACACATACACACAACACACACACAGCAAGCAAACTCCAGCCTGTGCCTGTCAGGGCTCCTGGGGCAGCTGCCCGCCTCGTGGGCCCTGTGTATGGCAGGCATATGGCAGAGACCCTGGGTGCTCTGGGGTGCAGTGGGCATGGAAAGCTTACTCTTTTTGTCCACTGGAGAGTGAGAGAACTGTTCACAGTTCATCTGTGTCTAATTATCTGATTTTTTTTTTAACGGTCTTGTGGTCTTTTACCCCTCCCTCCTTGAAGGTCCTGTGGGAAGGCTGGTGCCCAGGCTCCGTTCTGAGCAGGCTGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAATGTATAAATTAGTGTAAGGAATTCCTGGATTGTGTGTTTAAGTCCTCTAACGCAGGCGTGCAAGGTGGAGGGTTGAACCCTGTCTGGATTACAGAGTGTTAGAGACTCAAGTTTGGAAGTCCAGCTAGCGGCAGTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCACAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCTGAAGGGAAAACTGAACTAGACAGTTCCCTTCTGTGTCTAAATTTTCCAAAAGGTTGATTTGCTTAATATAGTAGTGTATACAATGGATAAATTGCTGTTACTTCAAGAATTAAAATTCTCATTTTCTCCCTTTCTGTTTTTTTTCCTTATATTCAACACTTTATGATGCCCTTTTGTCACTATCCTACTCAAAGAGGAAAGGAGAACCCACCAGACCTGTCCCAGTGACTCTACCTTTGTTCTAGAAGGCGCTCCTTTCAGGGTTGTGGTACCTGTAGGTTAGCAGACCCTCCTCCTTTCCCACCCACCCAAGTGTGGCCCAGCACTAACCCACCGTCTCTTGGGTTGAGCCCTGGCAGTTCTGTCCCTTCCCGAGGTCCTGCCCTGCATCATGGCTTGCTTCCTGGAGCACTTCCCCTTCAGAGGTCTACATTCTAGGGTGTAGGCTGAGTTCTTCTGTAAAGAGACGAACGTGATGCCAATAAAATTTAACAAGAACAAA