Transcript asmbl_53721

Sequence
Transcript Sequence for observation asmbl_53721 of TGE0000988:
NNNNNNNNGGTGTCTCTCTTCGAGTGTGGAATCCTCTGGTTATCGTCGCCATCCTGGTCTCGGGGGCACCGATCTCAGGGTCTTCGGGAGGAGAATTCTTGCCGTTACTGATTTCTCGCTGAAGGCAGTGTCCTATGCAAGGGGACGTTAGGAGCACCCGATTTGGCGCCCTGGGGCCTTGCGGCCTTTGCCGCCCGAAGAGGGGCGCGATGAGCGGGAATGGGGGCTTCAGGGTGACCTCCGAAAATGGTTCGCTATTCACTTGACCCAGAAAACCCCACTAAATCATGCAAATCAAGAGGTTCAAATCTTCGTGTTCACTTTAAGAATACTCGTGAAACTGCCCAGGCCATCAAGGGTATGCATATTCGAAAAGCCACCAAGTATCTGAAGGATGTCACTTTACAGAAGCAATGTGTACCATTCCGTCGTTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGATGGCCTAAAAAGAGTGCTGAATTCTTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAGGTGAACAAAGCTCCCAAGATGCGGCGCAGAACTTACAGAGCTCATGGGCGGATTAACCCCTACATGAGCTCTCCTTGCCACATTGAGATGATCCTTACTGAAAAAGAACAGATTGTTCCTAAACCAGAAGAAGAGGTTGCACAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCCCGGGAGTAAATTTAGCATCAAATAAATGCTAGTAAAAGTAAAAGCAGAATGTCGATTGTCTTTATTAGTAAATATACTTCAGGTCTCCGTGCAAGATGGATCAAACGTGTTTTCTTCTGATTAGAAATAGAAAC