Transcript asmbl_5358

Sequence
Transcript Sequence for observation asmbl_5358 of TGE0006275:
CGCGCACACTGCAGGAGCTGCCGCCGCCGCAGCCCGCGCCTTTAAGGTCTCACCGCTTCCTCAGCAGAGACCTGGACTCAGCCGCCATGTCCGCCACGGAGGAGGTTGACGGGCTGGGCGTGTCCCGGCCGCACTATGGCTCTGTCCTGGATAATGAGAGACTCACTGCAGAGGAGATGGATGAAAGAAGACGTCAGAATGTGGCCTACGAATACCTTTGTCATTTGGAAGAAGCAAAGAGGTGGATGGAAGCATGTCTCGGGGAAGATCTGCCTCCCACCACAGAACTGGAGGAGGGGCTGAGGAATGGAGTCTATCTCGCCAAGCTAGGAAACTTCTTCTCTCCCAAGGTGGTGTCCCTGAAAAAAATCTATGATCGAGAGCAGACCAGATACAAGGCAACTGGCCTCCACTTTAGACACACTGATAATGTGATTCAGTGGTTGAATGCCATGGATGAGATTGGATTGCCTAAGATTTTTTATCCAGAAACTACAGATATCTATGATCGAAAGAACATGCCAAGATGTATCTACTGTATCCATGCACTCAGCTTATACCTATTCAAACTAGGCCTGGCTCCTCAGATTCAAGACCTGTATGGAAAGGTTGACTTCACAGAGGAAGAAATCAACAACATGAAGATTGAACTGGAGAAGTATGGGATCCAGATGCCTGCCTTCAGCAAGATCGGGGGCATCCTGGCTAATGAACTCTCAGTGGATGAAGCTGCATTACATGCCGCCGTTATTGCTATTAATGAAGCTGTTGACCGTAGAATTCCAGCTGACACGTTTGCAGCTTTGAAAAACCCCAATGCCATGCTTGTAAATCTTGAAGAGCCCTTGGCTTCCACCTACCAGGATATACTCTACCAGGCCAAGCAGGACAAAATGACAAATGCTAAAAACAGGACAGAAAACTCTGAGAGAGAGAGGGACGTTTATGAGGAGCTGCTCACTCAAGCTGAAATTCAAGGCAATATAAACAAAGTCAATACATTATCTGCATTAGCCAATATAGACCTGGCTTTGGATCAGGGAGCTGCTCCGGCCTTGTTCAGGGTTCTGCAGTCCCCGGCGTTGGGCCTTCGAGGACTGCAGCAGCAGAACAGCGACTGGTACCTCAAGCAGCTGCTAAGTGAGAGACAGCAGAAGAGACAGAGTGGCCAGGCTGATCCCCTGCAGAAGGAGGAGCTACAGGCTGGAGTGGACGCCGCCAACAGCGCCGCTCAGCAGTACCAGAGAAGGCTGGCAGCCGTGGCAGCGATTAATGCTGCCATCCAGAAGGGTGTGGCGGAGAAGACTGTTCTGGAACTCATGAATCCCGAAGCCCAGCTGCCCCAGGTGTATCCGTTTGCTGCCGATCTGTATCAGAAAGAGCTGGCTACCCTGCAGCAACAGAGTCCGGAACATAGCCTCACCCACCCCGAGCTCTCCGTTGCAGTGGAGATGTTGTCGTCAGTGGCCCTCATCAACAGGGCACTGGAGTCTGGAGACATGAACACTGTGTGGAAACAGCTGAGCAGTTCAGTTACAGGCCTTACCAATATTGAAGAAGAAAACTGTCAGAGGTATCTTGATGAGCTAATGAAGCTGAAAGCTCAGGCACGTGCAGAGAATAACGAATTTATCACCTGGAATGACATCCAAGCTTGTGTGGACCATGTGAATCTGGTGGTGCAGGAGGAACACGAGAGGATTTTAGCCATCGGTTTAATTAACGAAGCCCTGGATGAAGGCGATGCCCAAAAGACTCTGCAGGCCCTGCAGATTCCTGCAGCTAAACTTGAGGGCGTCCTGGCAGAAGTGGCCCAGCATTACCAGGACACACTGATCCGGGCAAAGAGAGAAAAAGCCCAGGAAACCCAAGATGAGTCAGCTGTGTTATGGTTGGATGAAATTCAGGGTGCAGTCTGGCAGTCCAACAAAGACACCCAAGAAGCACAGAGGTTTGCCTTAGGAATTTTTGCCATTAATGAGGCCGTGGACAGTGGTGACATTGGTAAAACACTGAGTGCCCTGCGTTCCCCTGACGTCGGCTTGTACGGAGTCATCCCTGAGTGTGGTGAAACTTACCAGAGTGACCTGGCCGAAGCTAAGAAGAAAAAACTGGCAGCAGGAGATAATAACAGCAAGTGGGCAAAGCACTGGGTGAAAGGTGGATATTATTATTACCACAATCTGGAGACCCAGGAAGGAGGATGGGATGAACCACCAGGCTTTGTGCAAAATTCTATGCAGCTTTCTCGGGAGGAAATCCAGAGTTCCATTTCTGGAGTGACTGCTGCATATAACCGAGAACAGCTTTGGCTGGCCAATGAAGGCTTGATCACCAAGCTGCAGGCTTGCTGCCGTGGATACTTAGTCCGACAGGAATTCCGGTCCAGGATGAATTTCCTGAAGAAACAAATCCCTGCCATCACCTGCATTCAGTCGCAGTGGAGAGGATACAAGCAGAAAAAGGCGTATCAAGACCGTTTAGCGTACCTGCACTCCCATAAAGACGAGGTGGTAAAGATTCAGTCCCTGGCGAGGATGCATCAAGCCAGAAAGCGCTATAGAGATCGCCTGCAGTATTTCCGAGACCACATAAACGACATTATCAAAATCCAGGCTTTTATTCGGGCAAACAAAGCTCGTGATGACTACAAGACTCTCATCAATGCTGAGGATCCGCCGATGGTCGTGGTCCGGAAATTTGTCCACCTGCTCGACCAGAGTGACCAAGATTTTCAGGAGGAGTTGGATCTTATGAAGATGCGGGAAGAGGTCATCACCCTCATTCGTTCCAACCAACAGCTGGAGAATGACCTCAATCTCATGGATATCAAAATCGGGCTGCTAGTGAAAAATAAAATCACACTGCAGGATGTAGTTTCCCACAGTAAAAAACTTACCAAAAAAAATAAGGAACAGTTGTCCGACATGATGATGCTAAACAAACAGAAAGGAGGTCTCAAAGCTTTGAGCAAGGAGAAGAGAGAGAAACTGGAAGCTTATCAACACTTGTTTTATTTATTGCAGACCAACCCCACCTATCTGGCCAAGCTGATTTTCCAGATGCCCCAGAACAAGTCCACCAAGTTCATGGACTCTGTGATCTTCACTCTCTACAACTATGCATCCAACCAGCGAGAGGAATACCTGCTCCTGCGGCTCTTTAAGACCGCCCTACAGGAGGAAATCAAGTCAAAAGTAGACCAGATTCAGGAGATTGTGACGGGAAATCCTACAGTTATTAAGATGGTTGTGAGTTTCAACCGTGGTGCCAGAGGCCAGAATGCCCTGAGACAGATCCTGGCCCCAGTCGTGAAGGAGATTATGGATGACAAGTCTCTCAACATCAAAACTGACCCCGTGGACATTTACAAGTCGTGGGTTAATCAGATGGAGTCTCAGACAGGAGAAGCAAGCAAACTGCCCTATGACGTGACTCCTGAGCAGGCTCTAGCTCATGAAGAGGTCAAGACACGTCTGGACAACTCCATCAGGAACATGCGGGCCGTGACAGACAAGTTCCTCTCCGCCATCATCAGCTCAGTGGACAAAATCCCCTACGGGATGCGCTTCATTGCCAAAGTGCTGAAGGACTCGCTGCACGAGAAGTTCCCTGATGCTGGTGAGGATGAGCTGCTGAAGATCATTGGCAACTTGCTTTACTATCGATACATGAATCCAGCCATTGTCGCTCCTGATGCCTTTGACATCATTGACCTGTCGGCAGGAGGCCAGCTTACCACAGACCAGCGCCGAAATCTTGGCTCCATTGCAAAGATGCTCCAACATGCAGCTTCCAATAAGATGTTTCTGGGAGATAATGCTCACTTAAGCATCATTAATGAGTATCTTTCCCAGTCCTACCAGAAATTCAGACGGTTTTTCCAAACTGCTTGTGATGTCCCAGAGCTTCAGGATAAATTCAATGTGGATGAGTACTCTGACCTAGTGACCCTCACCAAACCAGTGATCTACATTTCCATTGGTGAAATCATCAACACTCACACGCTCCTGTTAGATCACCAGGACGCCATTGCTCCGGAGCACAATGATCCAATCCACGAGCTGCTGGACGACCTTGGCGAGGTGCCCACCATTGAGTCCCTGATAGGAGAAAGCGCTGGCAATTTAAATGACCCAAATAAGGAGGCGCTGGCTAAGACAGAAGTGTCTCTCACACTGACCAACAAGTTTGATGTGCCTGGGGATGAGAATGCAGAAATGGATGCTCGGACCATCTTACTTAACACAAAACGTTTAATTGTGGATGTCATCCGGTTCCAGCCGGGAGAGACCTTGACTGAAATCCTAGAAACACCAGCCACCAGTGAACAGGAAGCAGAACATCAGAGGGCCATGCAGAGACGTGCTATCCGTGACGCCAAAACTCCTGACAAGATGAAAAAGTCAAAATTTGTAAAGGAAGACAGCAACCTCACTCTGCAGGAGAAGAAGGAAAAGATCCAGTCAGGCCTGAAGAAGCTAACGGAGCTTGGGACCGTGAACCCAAAGAACAAATACCAGGAACTAATCAACGACATTGCCAGGGATATTCGGAATCAGCGGAGATACCGCCAGAGGAGAAAGGCTGAGCTGGTGAAACTGCAGCAAACATACGCTGCTCTGAACTCTAAGGCCACCTTTTACGGAGAGCAGGTGGATTACTATAAAAGCTATATCAAAACCTGCTTGGATAACTTAGCCAGCAAGGGCAAGGTCTCCAAGAAGCCTAGGGAAATGAAAGGAAAGAAGAGCAAAAAGATTTCTCTTAAATATACAGCAGCAAGACTACATGAAAAAGGAGTCCTTCTGGAAATTGAGGACCTACAAGCGAATCAGTTTAAAAATGTTATCTTTGAAATCAGTCCAACAGAAGAAGTTGGAGACTTTGAAGTGAAAGCCAAATTCATGGGAGTTCAGATGGAGACGTTTATGCTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTTCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAACTGATCATTTGCTGCCAGCACAGAAGGATGAAGGAAAGAAGTGCTTCACGGTTACCTTCCTAGGGCCCTTTTTTACCCACTGGAAGCAGAGACCCAACCCACACGGTGCTCGATACACTCCCAATGCCACATCTTTAACTCTTCCCTCTCTGACTGGACATTTGTAGCCCCCTTTTCATAGCGAGATTGTATTTCAGGCTTAGTCTGACCCTTCTTATTCCTTCATTTTCTTCTGTCACTTAGGAAGGAGTGGGAACTTGACCAAAACCTATCTGTGTTGTTTATAATGGTCTTAGAGGTTGCATTACTATATTGTAAGCTTTGGTGTTTGTTTTAATCTGCATTAGGGATGGTGGGATTTGAATTCTTGTTATTTAGAAGTGGAAGCTGTTAGCACCAATGACATACATTGATATAAGACACAATCAAAATGTCAGATTACCCGTAGTTCTTCGGCTGTCATTTAAAAGTGAAGTTCCTTCACAGTAAAACGGAAGGATGTGGGGTATCATCGCTCCTCTTCTGTTTTGTTTCCCTTTATAGGCAGGAGCTAATAGAAGCCACTGTACTGTGTTCAGAGGAAGCATTTCTAGAAAAGGGGATGATATCATTTTTAAACTTTACCATCAAATTTGGACACTTCTGTTAGAGTAACTCTTGTCATTGAATGGTAGAGTCCCATTGATAAAATTCGGCCATTTAGGTGGATTTATAATGGTCTGTGGTGTCCCTCCTCTTTGAGGTGTCTGCTTGTCTGCTTCAGTGCAGAGATTGACTGGTTCAGGAAGATGGCCCACTTTGTCGCTGTGATAGAGGAATGGGTTAGCTTAGCTTAGGATATAATTTTTTTCAAAGCTGTTTTATATCTTAAGAGTGCCTTATTAAAGTGTAGATTTATTTCTTAAAATGTGGGTGATAGGAATTTTAAAGATTTATATAATGCTTCAAAGCCATTAGAATATGGTAAGAAAAGGTTTTTTAAAATGGGCTTATCTGTATATCTGAACTCTTAAAACTTTCTTATAGCTAAAACACTAGGATTTGTCTGCAGAGTCGCAGAGATAATCCTGCCTTAAGTAGATGGAAACAAAAATAAACAGAACCAGCCAACCAACGTTACACATGATATCAAGTCTGTTTCCCCATTTTTTTCTCTCTCCTCCTGCCCACACTGCTTTTATCTTATGAGCTCCAGTTTTCTGGGTTTAGTCAAAAAATTCAGTTCTAAACATTGAATTTCTAGGAAGTTTTTGTTCTTAGATAAAAAGTCATACTTTTTAAAAAAATCTGTTTATCCAGGAGAACAGTGAAATCATGCTACTGAGCCTCAATTTTCTCTGATATTTTGGTTCAGTATTCTTTTATCACAAAACATAAAACTTAACAAAATAAACTAACATCTATAAATTGATCTATGTATATTTAAATACAATAAACTGTTTTGTCAATAACAAATTATGTGATGTGTCCCTATTACAAATGTAAGTGCTGGAGACGTGTTTTTCATGATGCACTGTTTACTCAGTCAGGTCCATGGGTGCAAATGTACCCACTGCAGGCAGACCCCTGGCAGGTGAGGTGGGGCATGCCACTGACGGAAGGAGTCTCCGCTACCCTGACCTCGTTTTTTGTTGTATTTTGGAAGATAATTTTTTAGTAAATATTTTTCTTATATTAAAAGAAGATGCTATTGCAAGTAGCATCGCCTCAGAAACTGGGACCAATGCTTTTACCTTGAAGGAGGATGGATACCCATCGCGCATGTTTGTCAGGTTCCAAAGGCCACACCCATGACCGACAGTGAGCTGAGTTTACAACTCCTTTAATAAAACATGATGTTTCAATTATTTGTAAGGATTATAGTTCCCTTGACACAACATTTAATGCAAAGTAGCACAAAACGCACTTCGAGAGTTTTGATGGTGACTATATATTGAATTGTAGTTTTAATGACATTGAGAAGGCCCGGGTGAACTCAAGTGGCATTGAAACAGTGTAGTTCTTAGTCCTTTTATTTATTAGCTGTAGCGTTCTCCACCTTGTCTCTCTCCTTCTATGATCTTCTGTTCCACCAGCCATCGTGACATTTATCATGAATTTACCTCCTCCCAAGAATTCGGACTGCCTGCCCATCAGATTGTTGCCGCACACAATTGCCTTTGTATCTCTGTATGAAATAAAAGGTCATTTGTTCA