Transcript asmbl_43734

Sequence
Transcript Sequence for observation asmbl_43734 of TGE0004149:
TAAAGAAGTCCCGGCCGGGCCGCTGCACTCCCGCGCGCGCATCCGTGCGCCGCCCGAGGCTGGCCTGAGGAGTCGGCGGCCATCTTGTTCTTCTCGTGGTTCCCAGTGGCGAGAGGAGGAGGAAGCCCGGAGCGGAGCGGGGCGGCTGGGGGGGGTGGACCCGCCGCGGCTGCTGCTGCCACCGCCGCCGCCGCCACCACCGCTCGTGGGGCTCGTGGCGTGAGGAAGGAGGACGAGTGAGACCCCGGGGCGAGCGGGCGGCGGCGCCGCTGCTGCTGCTGCTGCTGCGGGAGGGTCGGCGGCGGGACGGCGATGGCGGATATCGACAAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCAGGCAAGAATGTCCAGCTCCAGGAGAACGAGATCCGAGGACTCTGCCTGAAGTCTCGGGAGATCTTCCTCAGTCAGCCTATCCTTTTAGAACTTGAAGCACCACTCAAGATATGTGGTGACATCCACGGGCAGTACTATGATTTGCTCCGTCTGTTTGAATACGGTGGCTTTCCTCCAGAGAGCAACTATTTGTTTCTCGGGGACTATGTGGACAGGGGCAAGCAGTCCCTGGAGACAATCTGCCTCTTGCTGGCCTACAAAATCAAGTATCCGGAGAACTTCTTTCTTCTCAGAGGGAACCACGAGTGCGCCAGCATCAATAGGATCTACGGATTTTATGATGAGTGTAAAAGAAGATACAACATTAAGCTGTGGAAAACGTTCACAGACTGTTTTAACTGCTTGCCGATAGCAGCCATCGTGGACGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGAGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGCTATGAGTTTTTTGCAAAGAGGCAGTTAGTCACTCTGTTTTCTGCACCCAACTACTGTGGCGAGTTTGACAATGCAGGCGCCATGATGAGTGTGGATGAGACCCTCATGTGTTCCTTCCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCCAACGCCACGAGACCTGTCACACCACCACGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCACTTGACACTGCCTGGTTGGGACTTGTAACATAGCGTTCATAACCTTCCTTTTTAAACTGTGATGTGCTGGTCAGCTTGCCCAGGTAGACCTGTCTGTCGGGCCCTCCTCCATTTGATTACTGCTGGCACTTGCTGGTTATAGCAGCAAGCCAAGCACTTCATTCTCAAGAGAGCATTTTGTTTTGAACCTCTGTTCCCTTTGTGGACAGCTCTGATGATGGTGTTAAGCTGTACACCCTGGCAGGTTATCCTGTCTGAGGAGAAAGTGTACAATTGATCTTTTTTTAATTTAGTATAAGTCATGAATAATGTAAATGCCTGTTTTCTTTAGGATATAAAGAGAGCCTTAGAGTGCGTGAGTCTCTACATGTAATTGTCATAAATGCATTCTGTTGATACAAACCACTGTGAACAATTTTTTTTCCAGTTTGTTTGAAAGGGACTGCTTTCCCTCATTGTCTTGTCATGTACAAACTAGTGTCTGCAGCTGTGGCAGCAGGAGTGACCTGCCTGCCGCCAGCCCTGCCCAGACTATCTGAAGCACACTCCTTCCCACTGCACATTTAATAATGATTAAAGCCATTCTTTTCAATGTCTGTGATTCCTTCCTAAAGCCAAAGTTTCTGTTGGACTGTATGGCACGCCCTGGGGATGAGGTGGCCAGGGCATCGAGGCTGCGTGCACAGGCCGCCTCCCTCCGTGGGGCCTCAGAAGCAGGTTATTTTAACTAGCAATAGTGGTATAGTGCTGAGTAAGCTATTAATGATGGAAGTTAATGACACTTTGTACAGTTCCCATATAGTCTATTCACTGAGTGATCTTTTTACAGTTGGATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAACACTGTCCTATACGAGTGACCGATAATGCTTTCTTTGGCTACATTCTTTATTCTGCGGTGACATTGAGGCTTATAAATCAAAAGGAACTAACTTGCCGTCCACCGGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAACTACGACCTGTTAAATGAATCTGTTTGCACAGATGCCCGTGTACAATGCCATGTGCTGAGAATGGTTTCAGACTTATTAAATGCAAGCTTGTTAACTTG