Transcript asmbl_53514

Sequence
Transcript Sequence for observation asmbl_53514 of TGE0006272:
CGGGAAGCCAATTCTGGGGACCGGTAGTGGAACGCTCTGGGGCTCATTTCCGGCCACCTCAGCGGGAAGCGAAGACGCAAGCAGCTAGACCGTGGGGAACCGAGGTAGGAGTTAACTGTTGTAGCGGCGGAGGAAGTCGGGAGGACGCCGACGGCCTTGCGGGCCAGTGTTTGGTCCCTTTAACCTGTGAAGATGGTGTTGCTCACGATGATCGCCCGAGTGGCGGACGGGCTCCCGCTGGCCGCCTCGATGCAGGAGGACGAACAGTCTGGCCGGGACCTCCAACAGTACCAGAGTCAGGCTAAGCAGCTCTTCCGGAAGTTGAATGAACAGTCCCCTACCAGGTGTACCCTGGAAGCTGGCCCCATGGCTTTTCACTACATTATTGAACAAGGGGTGTGTTACTTGGTTTTGTGTGAAGCCGCCTTCCCTAAGAAGTTGGCTTTCGCCTACCTAGAAGATTTACACTCAGAGTTTGATGAACAGCATGGGAAGAAGGTGCCCACTGTGTCTAGACCCTATTCCTTTATTGAGTTTGATACCTACATTCAGAAAACCAAGAAGCTCTACATTGACAGTCGTGCCCGGAGGAACCTAGGCTCCATCAACACTGAGCTGCAGGACGTGCAGAGGATCATGGTGGCCAACATCGAAGAAGTGCTCCAGCGAGGGGAAGCGCTCTCAGCATTGGATTCAAAGGCTAACAATTTGTCCAGTCTGTCCAAGAAATACCGCCAGGATGCGAAGTACTTGAACATGCGTTCCACTTACGCCAAACTCGCAGCCGTGGCCGTGTTTTTCATCATGTTGATAGTGTATGTGCGATTCTGGTGGCTGTGAAGTCGCGAATCCAGTCACTGGCAAGGGAGAACGTAGAACCTGACAGGTGTATGTTTTCGGGAAACCGAGCTCACAGAGATATGTATTAGAATCCAACTGGAACTTCCGCCTCTAAAGACCTTGCGAGAAAAGACACATCCTGAAAATGAAAGGTCACACCTCCTTTCATGCAGCTTAACCCCATGTAGAAAGTCTCTTTTGGGGGCAGACGCTTTCTCTGGGTGCTAAGCCGTATGTACGTTAGGGAACAGTAGGTCGTTGCATTTTGTTTTTTCCTCTCCTAGTGTTTTACATTTTTTTAAAGCTGCACTTACTGGGGCATCTTCATCCTCTAACAGAGCCATCAGTGAGATTGGGGTTAACCAACCTGTGCTAGCAGCAGTCTGAAATTCCTTCAGAGAAGGAAGCCCTTTGGGAAGTTTTTGACGATCTAATCAACATTCCTTTTGTCAGCGACATTTGTGATTTTCCGTAATCTGAGTTTTCGATGGCCTTTTCAACAAGACTCCAGCATGTGAAGGTTCATTGCTGTGTGTGCTGCAAAGATCTTGTCTCTTGGCCCCGATAGGAAGTTAACCTTTGTTCCCCTTTTGTATTTTGCTTATTGCACAATTGCTTTAGGGTTAAATTAATTATATTAAGATGCCTTGAAATTATATTATAGCACTCCTTGATTAAGAAGCTAAAATGTTTTCTGTCATTTATTCCTTAAAAGACTTAAGTTAGTTTGGGACAGTCTTTATTTTCAGCATCTGATGTGTGTTAATTAAAGAGGGAGGATAGTACACAGATAGCCAGAGGCCCCTGACTCAATGAGAACAGACCGTGACTGCGGCTTTGTCCCTCCCCTTCCTCACTGTCCCCGCTCGTTTCCCCCACTCTCTTTCCTCCTGCCTCAATTTGCTAACAATTTAAAAACTCTTGTGCCCAATAGTTTCATGTCCCTTAAGTGTCCTCTCAGGACAGTCTCAGATTTCAAAATGGAGAACGTTCAGCTGTGTAGTTCATTACATTTAAGTTTTTGCAGAGTGACAAAAACTACTAAATACGTTTACCCGGAACGTCTCTCAGAGCACCCCACACCTGCTTCAGTTTGTAGAAGTTCTCTGAGAATGTTCTAGACATAGAGAACTCATTTACAGTGGCTTCTGTTCACAAATAAAAGGACCTGCGATTGTCCCCTTTTTGCTCAGGGATAATGGGGATTTCCTTGTACCTTCTGAGACAGAATTTTTAAAATGCGAGGATAGGCCTTTTAGATATGTCACAAGGGTCTGCGCTATGACCTATAACTCCTACATATACTGAAAATATTTCTTTAAATTGTACAGGAAAATGAGCCAACTTCTTACTTCTTAACATCCTGAAAAAACTCCAACCAGTGAGCAATTTTATAATGCTGTGGGGTCATCAAATCTACTGTCCTGATTCCTGATAGAGGAAAAAAAAAATTCTATTTCCTTCTAACAAGGCAAGGAGAAACACTTTTATTCCTGATAATTTACAGAACTAGAATAAAATTTTTGTCTTTCCATTTTGGACCTAAATGTGCCAGTTGGCATTTTGTGCATGGAATATGAAATTACTTTTTATAGAGAATAAGTGCTTTTCGGTCCCAAAGGCTTGTCCCTGAGTAATGATGGTGGTAACGCGAGCCTTCGAAAGGGGGAAAACCTGAGCAGTGGCGCCCTAGCGTCCGGTGCTCCTGGCACAGGGAGCGTGGCAGCTCGTTGTCGAGAGTTGCATGCTGTAACCAAGTGGCCAGCAATGAAATAAATACTTCTAGAATGTTTCCTTCAGTGTGAAGTTTTGTTACCTAGTTTATTTATGCACACATGTCCTTCCAGGTGTATTTCTACCTAACCTCAGTGGGTTAATTAAAAAAGGAGAAGGCGGGGTATGGAATGACAAAGGAATAGGAAAACGGTTTAAGGTTACGATGGTAGCAAAATGAGAGAAAAAACAGTCATAATACGGCTGCTGCTTCTGTTCTTTACTGGAGATGGTGGGAAACGAAGATGAAATGTATCGGCAGCCAAACAGGCCTCTGAAATATAATGCCATAAGCACTGTCCAGGGTTTTGGGGGACACACTGGGAAAGGACACCTAATTTGGGAGGGAATGTGATAAGAAGAGGCAAATGGGGTATTCTAGACGGAGTCAGTGGCTTGTACAAAGTCACGAGTTAAAAGAATAAGGCATGTTTGGGGGATTGTAATTAGCTTGGCTCAACATAACCCGAGGGTAAGTGTAGGCATTTGAGACTGGAGGAAGAGCCAGGCGAGGCGACTGTCATAAAGTCTTGTCTATCGTGCTGAGGAGCTTAG