Transcript asmbl_53489

Sequence
Transcript Sequence for observation asmbl_53489 of TGE0006270:
CTTATGGCGGCGCTGGAAAGGGGGCGCTGAGCTGTTGGGTATGAAGTGTAACAGAACAGACTTTACCACCTGAAACTGCTGCTTCAAGTTCAGATCAGGCAAGGAACAAACCTCGAAACAACCAACAAGACCAAAGAAGAGTACACTTTAAATTGAAGACACAACACTTGATCTGAAACAAGAAGTTTGTGCCTACTCAACAGCTTTGAAAGAGCACTTCCCAACGCTGCTAGTAGTCTTTGTTTTCTTCAGTGCTGTACTGTGAGATTGCCCGGTGCAGCAGCAGTTGTATTCTTTATTAGCCTGATAGATCATTTTCTCTCGCTCTTTTTTTTAATACTAGCAACTTTCATCCTTTGAAACGTGTGCTGAAAAAGAAGAATCAGCAAATACTACTGAAAGTGCAATATTTGATTATCACTGCGAGATGAGCTTTGATCCAAACCTTCTCCACAACAATGGACACAACGGGTACCCTAATGGTACTTCAGCAGCACTGCGTGAAACTGGGGTTATTGAAAAACTGCTAACCTCTTACGGATTTATTCAGTGTTCAGAACGTCAAGCTAGACTTTTCTTCCACTGTTCACAGTATAATGGCAACCTGCAGGACTTAAAAGTAGGAGATGATGTTGAATTTGAAGTATCATCTGACCGGCGGACTGGGAAACCCATTGCTATTAAACTGGTGAAGATAAAACCAGAAATCCTCCCTGAAGAACGAATGAATGGACAAGTTGTGTGCGCTGTTCCTCACAACTTAGAGAGTAAATCTCCAGCTGCCCCGGGTCAGAGTCCAACAGGGAGTGTATGCTACGAACGTAATGGGGAAGTGTTTTATCTGACTTACACCCCTGAAGATGTGGAAGGGAATGTTCAGCTGGAAACCGGAGATAAAATTAACTTTGTAATTGATAACAATAAACATACTGGTGCTGTGAGTGCTCGAAACATTATGCTGTTGAAAAAGAAACAAGCCCGCTGTCAGGGAGTAGTTTGTGCCATGAAGGAGGCGTTTGGCTTTATTGAAAGAGGTGATATTGTAAAAGAGATATTCTTTCACTATAGTGAATTTAAGGATGACTTAGAAACCTTACAGCCTGGAGATGACGTGGAATTCACAATCAAGGACAGAAATGGTAAAGAAGTTGCAACAGATGTCAGACTATTGCCTCAAGGAACAGTCATCTTTGAAGATATCAGCATTGAACATTTCGAAGGAACTGTAACCAAAGTTATCCCAAAAGTACCCAGTAAAAACCAGAGTGACCCATTGCCAGGACGCATCAAAGTTGACTTTGTGATTCCTAAAGAACTTCCCTTTGGAGACAAAGATACAAAATCCAAGGTGACCCTTTTGGAAGGTGACCATGTTAGGTTTAATATTTCAACAGACCGACGCGACAAATTAGAACGAGCAACCAACATAGAAGTTCTATCAAACACGTTTCAGTTCACTAATGAAGCCAGAGAAATGGGTGTAATTGCTGCCATGAGAGATGGTTTTGGTTTCATCAAGTGTGTGGATCGTGATGCTCGTATGTTCTTCCACTATAGTGAAGTTCTGGATGGGAACCAGCTCCATATTGCAGATGAAGTAGAGTTCACTGTGGTTCCTGATATGCTCTCTGCCCAAAGAAATCATGCTATTAGGATTAAAAAGCTTCCCAAGGGCACGGTTTCATTCCATTCTCATTCAGATCATCGTTTTCTGGGCACTGTAGAAAAAGAAGCCACTTTTTCCAATCCTAAAACCACTAGCCCAAATAAAGGCAAAGAAAAGGAGGCTGAGGATGGTATTATTGTTTATGATGATTGTGGAGTGAAATTGACTATTGCTTTTCAAGCCAAGGATGTGGAAGGATCTACTTCTCCTCAAATAGGAGATAAGGTTGAATTCAGTATTAGTGACAAACAGAGGCCTGGACAGCAGATTGCAACTTGTGTGCGACTTTTAGGTCGTAATTCTAACTCCAAGAGGCTCTTGGGTTATGTGGCGACTCTGAAGGATAATTTTGGATTTATTGAAACAGCTAATCATGATAAGGAAATCTTTTTCCATTACAGTGAGTTCTCTGGTGATGTCGATAGTCTGGAACTGGGGGACATGGTCGAGTACAGCTTGTCCAAAGGCAAAGGCAACAAAGTCAGTGCAGAAAAAGTCAACAAAACGCACTCGGTGAATGGCATTACTGAAGAAGCTGATCCTACCATCTACTCTGGTAAAGTCATTCGCCCCTTGAGGAGTGTTGATCCGACACAGACTGAGTACCAAGGAATGATTGAGATCGTGGAGGAAGGGGATATGAAAGGTGAGGTCTATCCATTTGGCATAGTTGGAATGGCCAACAAAGGGGATTGCCTACAGAAAGGGGAGAGTGTCAAGTTCCAATTGTGTGTCCTGGGCCAGAATGCACAGACTATGGCCTACAATATCACACCCCTACGTAGGGCCACAGTGGAATGTGTGAAAGATCAGTTTGGCTTCATTAACTATGAAGTAGGAGATAGCAAGAAGCTCTTTTTCCATGTGAAAGAAGTTCAGGATGGCATTGAGCTACAGGCCGGAGATGAGGTGGAATTCTCAGTGATTCTTAATCAGCGCACTGGCAAGTGCAGTGCTTGTAATGTTTGGCGAGTCTGCGAAGGCCCCAAGGCTGTTGCAGCTCCACGACCTGATAGGTTGGTCAATCGCTTGAAGAACATAACCCTGGATGATGCCAGTGCTCCTCGCCTAATGGTTCTTCGTCAGCCAAGGGGACCAGATAACTCAATGGGATTTGGTGCAGAAAGAAAGATCCGTCAGGCTGGTGTCATTGACTAACCACATCCACAAAGCACATCATTAATCCATTATGATCAAGTTGGGGGGATTCTGGTGAAGGGTTCTGAATATCTCCCTCTTCATCCCTCCCAAAATCTGGAATACTTATTCTATTGAGCTATTACACCAGTTTTAACACCTTCCTCGTGTTATGTTTAAAAAAAATAAATAAATTTAAGAAAACCATTTTAAAATTATGCACAGTTGCAGCCTGGAAAACTTAAGGTGGCGCCTTATAGTATCAATTTTAGAAGCTTTATTTGGTGCATTTAACGCAACTGGTAATTGCAAAATCCACTTCCCCTGTGTAAGTGAAAAGTATAGACTGTTATCTTGTTGGCCCTATGAAATTCTGCACTTGATATTCAGTATATACTCTACCTTCATTACTTCTGGCAAGGTGTTCGGCCTTAGCACTCAGTTGCATTCTTTCCTGTTCATTATGCTTTAATTCTGAGGACCATATGAGGGTAGAATATATTAAAAATTACAAAAATTTGTATAGGCGAACCATTTCCTTAAGTTGGTGGCCAAATGTTAAAATGTTATTTTTCATATCATTTATAATCTTGTCACAGTCCACTTAACAAAGTTTGGTTAGATTTCAATGAAAATTATCTTCCAGAGTAGTTTTTTTTTCCTGGGATGGGAGGGGGGTAAACTTTACTACAAATAGTATGTATGGTGCAGAATTTCATGCAAATGAGATGTGCCAGCAGTGTGATAATTTAAACGTATTTAAACAGAAACAACAAAAAAGGACAAATGCACAAACTCGCTGCTGCTTAGATCACTGCAGCTTCTAGGACCCAGTTTCTTTTACTGATTTCAAAACAAAACAAAAAAATAAAAAAGTTGTGCCTGAAATGAATCTTGTTTTTTTTATAAGTAGCCGCCTGGTTCCTGTGTCCTGTAAAATACAGGCACTTGACCCTTGGTGTAGCTTCTGTTCGACTTTATATCACGGGATTGGATTGGTCTGATTTCTTGGCCCTCATCTTGAATTGGCCACATACAGGACAGGGTCCCTGGCCAGTGGACTGAAGGTTTTGTCCACAAGATGACAAAAGGTCAGCTCAGGGGATGTGTGGGAGGGCACTTTTATCTTCCCCATTGTCATTTGAGTTTTTGATCTCTGGGTAAAGAGGCCGTTTATCTTTGTAAACACAAAACATTTTTGCTTTCTCCGGTTTTCTGTTAATGGCGAAAGAATGGAAGCGAATAAAGTTTTACTGATTTTTG