Transcript asmbl_53487

Sequence
Transcript Sequence for observation asmbl_53487 of TGE0006270:
AACTGGTAGCTCTCATGCACAGCTACCTGTTTATAAAACTATGAAGTGTAACAGAACAGACTTTACCACCTGAAACTGCTGCTTCAAGTTCAGATCAGGCAAGGAACAAACCTCGAAACAACCAACAAGACCAAAGAAGAGTACACTTTAAATTGAAGACACAACACTTGATCTGAAACAAGAAGTTTGTGCCTACTCAACAGCTTTGAAAGAGCACTTCCCAACGCTGCTAGTAGTCTTTGTTTTCTTCAGTGCTGTACTGTGAGATTGCCCGGTGCAGCAGCAGTTGTATTCTTTATTAGCCTGATAGATCATTTTCTCTCGCTCTTTTTTTTAATACTAGCAACTTTCATCCTTTGAAACGTGTGCTGAAAAAGAAGAATCAGCAAATACTACTGAAAGTGCAATATTTGATTATCACTGCGAGATGAGCTTTGATCCAAACCTTCTCCACAACAATGGACACAACGGGTACCCTAATGGTACTTCAGCAGCACTGCGTGAAACTGGGGTTATTGAAAAACTGCTAACCTCTTACGGATTTATTCAGTGTTCAGAACGTCAAGCTAGACTTTTCTTCCACTGTTCACAGTATAATGGCAACCTGCAGGACTTAAAAGTAGGAGATGATGTTGAATTTGAAGTATCATCTGACCGGCGGACTGGGAAACCCATTGCTATTAAACTGGTGAAGATAAAACCAGAAATCCTCCCTGAAGAACGAATGAATGGACAAGTTGTGTGCGCTGTTCCTCACAACTTAGAGAGTAAATCTCCAGCTGCCCCGGGTCAGAGTCCAACAGGGAGTGTATGCTACGAACGTAATGGGGAAGTGTTTTATCTGACTTACACCCCTGAAGATGTGGAAGGGAATGTTCAGCTGGAAACCGGAGATAAAATTAACTTTGTAATTGATAACAATAAACATACTGGTGCTGTGAGTGCTCGAAACATTATGCTGTTGAAAAAGAAACAAGCCCGCTGTCAGGGAGTAGTTTGTGCCATGAAGGAGGCGTTTGGCTTTATTGAAAGAGGTGATATTGTAAAAGAGATATTCTTTCACTATAGTGAATTTAAGGATGACTTAGAAACCTTACAGCCTGGAGATGACGTGGAATTCACAATCAAGGACAGAAATGGTAAAGAAGTTGCAACAGATGTCAGACTATTGCCTCAAGGAACAGTCATCTTTGAAGATATCAGCATTGAACATTTCGAAGGAACTGTAACCAAAGTTATCCCAAAAGTACCCAGTAAAAACCAGAGTGACCCATTGCCAGGACGCATCAAAGTTGACTTTGTGATTCCTAAAGAACTTCCCTTTGGAGACAAAGATACAAAATCCAAGGTGACCCTTTTGGAAGGTGACCATGTTAGGTTTAATATTTCAACAGACCGACGCGACAAATTAGAACGAGCAACCAACATAGAAGTTCTATCAAACACGTTTCAGTTCACTAATGAAGCCAGAGAAATGGGTGTAATTGCTGCCATGAGAGATGGTTTTGGTTTCATCAAGTGTGTGGATCGTGATGCTCGTATGTTCTTCCACTATAGTGAAGTTCTGGATGGGAACCAGCTCCATATTGCAGATGAAGTAGAGTTCACTGTGGTTCCTGATATGCTCTCTGCCCAAAGAAATCATGCTATTAGGATTAAAAAGCTTCCCAAGGGCACGGTTTCATTCCATTCTCATTCAGATCATCGTTTTCTGGGCACTGTAGAAAAAGAAGCCACTTTTTCCAATCCTAAAACCACTAGCCCAAATAAAGGCAAAGAAAAGGAGGCTGAGGATGGTATTATTGTTTATGATGATTGTGGAGTGAAATTGACTATTGCTTTTCAAGCCAAGGATGTGGAAGGATCTACTTCTCCTCAAATAGGAGATAAGGTTGAATTCAGTATTAGTGACAAACAGAGGCCTGGACAGCAGATTGCAACTTGTGTGCGACTTTTAGGTCGTAATTCTAACTCCAAGAGGCTCTTGGGTTATGTGGCGACTCTGAAGGATAATTTTGGATTTATTGAAACAGCTAATCATGATAAGGAAATCTTTTTCCATTACAGTGAGTTCTCTGGTGATGTCGATAGTCTGGAACTGGGGGACATGGTCGAGTACAGCTTGTCCAAAGGCAAAGGCAACAAAGTCAGTGCAGAAAAAGTCAACAAAACGCACTCGGTGAATGGCATTACTGAAGAAGCTGATCCTACCATCTACTCTGGTAAAGTCATTCGCCCCTTGAGGAGTGTTGATCCGACACAGACTGAGTACCAAGGAATGATTGAGATCGTGGAGGAAGGGGATATGAAAGGTGAGGTCTATCCATTTGGCATAGTTGGAATGGCCAACAAAGGGGATTGCCTACAGAAAGGGGAGAGTGTCAAGTTCCAATTGTGTGTCCTGGGCCAGAATGCACAGACTATGGCCTACAATATCACACCCCTACGTAGGGCCACAGTGGAATGTGTGAAAGATCAGTTTGGCTTCATTAACTATGAAGTAGGAGATAGCAAGAAGCTCTTTTTCCATGTGAAAGAAGTTCAGGATGGCATTGAGCTACAGGCCGGAGATGAGGTGGAATTCTCAGTGATTCTTAATCAGCGCACTGGCAAGTGCAGTGCTTGTAATGTTTGGCGAGTCTGCGAAGGCCCCAAGGCTGTTGCAGCTCCACGACCTGATAGGTTGGTCAATCGCTTGAAGAACATAACCCTGGATGATGCCAGTGCTCCTCGCCTAATGGTTCTTCGTCAGCCAAGGGGACCAGATAACTCAATGGGATTTGGTGCAGAAAGAAAGATCCGTCAGGCTGGTGTCATTGACTAACCACATCCACAAAGCACATCATTAATCCATTATGATCAAGTTGGGGGGATTCTGGTGAAGGGTTCTGAATATCTCCCTCTTCATCCCTCCCAAAATCTGGAATACTTATTCTATTGAGCTATTACACCAGTTTTAACACCTTCCTCGTGTTATGTTTAAAAAAAATAAATAAATTTAAGAAAACCATTTTAAAATTATGCACAGTTGCAGCCTGGAAAACTTAAGGTGGCGCCTTATAGTATCAATTTTAGAAGCTTTATTTGGTGCATTTAACGCAACTGGTAATTGCAAAATCCACTTCCCCTGTGTAAGTGAAAAGTATAGACTGTTATCTTGTTGGCCCTATGAAATTCTGCACTTGATATTCAGTATATACTCTACCTTCATTACTTCTGGCAAGGTGTTCGGCCTTAGCACTCAGTTGCATTCTTTCCTGTTCATTATGCTTTAATTCTGAGGACCATATGAGGGTAGAATATATTAAAAATTACAAAAATTTGTATAGGCGAACCATTTCCTTAAGTTGGTGGCCAAATGTTAAAATGTTATTTTTCATATCATTTATAATCTTGTCACAGTCCACTTAACAAAGTTTGGTTAGATTTCAATGAAAATTATCTTCCAGAGTAGTTTTTTTTTCCTGGGATGGGAGGGGGGTAAACTTTACTACAAATAGTATGTATGGTGCAGAATTTCATGCAAATGAGATGTGCCAGCAGTGTGATAATTTAAACGTATTTAAACAGAAACAACAAAAAAGGACAAATGCACAAACTCGCTGCTGCTTAGATCACTGCAGCTTCTAGGACCCAGTTTCTTTTACTGATTTCAAAACAAAACAAAAAAATAAAAAAGTTGTGCCTGAAATGAATCTTGTTTTTTTTATAAGTAGCCGCCTGGTTCCTGTGTCCTGTAAAATACAGGCACTTGACCCTTGGTGTAGCTTCTGTTCGACTTTATATCACGGGATTGGATTGGTCTGATTTCTTGGCCCTCATCTTGAATTGGCCACATACAGGACAGGGTCCCTGGCCAGTGGACTGAAGGTTTTGTCCACAAGATGACAAAAGGTCAGCTCAGGGGATGTGTGGGAGGGCACTTTTATCTTCCCCATTGTCATTTGAGTTTTTGATCTCTGGGTAAAGAGGCCGTTTATCTTTGTAAACACAAAACATTTTTGCTTTCTCCGGTTTTCTGTTAATGGCGAAAGAATGGAAGCGAATAAAGTTTTACTGATTTTTG