Transcript asmbl_53438

Sequence
Transcript Sequence for observation asmbl_53438 of TGE0001954:
CTCAGTTCTGCGGCAGTGTGAGTGGATAGAGTGGCGGTGCACTCGTGTTGGCTCTCAAAATCCCCGCGTAGCCACTGTCGCCTTTTCCAGCCCTCGCCATGTTCCTCACCCGGTCTGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATCGAGGCTATCAAGCTTGGTTCTACAGCTATTGGAATCCAGACATCAGAGGGTGTGTGCCTAGCTGTGGAGAAGAGAATTACCTCCCCACTCATGGAGCCAAGCAGCATTGAGAAAATTGTAGAGATTGATGCTCACATAGGTTGTGCCATGAGTGGGCTAATTGCTGACGCTAAGACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACATACAATGAGACAATGACAGTGGAGAGTGTGACCCAGGCTGTGTCCAATCTCGCTCTGCAGTTTGGAGAAGAAGATGCAGACCCGGGTGCCATGTCTCGTCCGTTTGGAGTAGCACTGTTATTTGGAGGAGTTGATGAGAAAGGACCCCAGCTGTTTCATATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCAGAGGGTGCCCAGAGCTCTTTGCAAGAAGTTTACCACAAGTCTATGACACTGAAAGAAGCCATCAAATCTTCACTCATCATCCTCAAACAAGTAATGGAGGAGAAGCTGAATGCAACTAACATAGAGCTAGCCACTGTGCAGCCCGGCCAGAATTTCCACATGTTCACAAAGGAGGAGCTCGAAGAGGTTATCAAGGACATTTAAGGAAGCGTGATCCTCAGAGCTTCTCTGGGACAGTTTCAGTTCTCCTAATTGCCCTTAACTTTTATTTCCAGCTCATATTCCTTGGAAAATCTCCAGTATATGTGCATTTTTTTATGATGTCTGTACATAAAGGCAGTTCTGAAATAAAGAAAAATTTAAAGTATTTGTTAATAGACTATTCTAATGCAGTCTTTTATTCAAACTGCTTATGTTAGGGAGCAAGAAAGATAGTGGTATTCATATCCCTGCCCTCTCAGAGTATCTATTCTGAAATAATTTTAGTGGCTTGCTGCAACAGAATCAACTATATCATGAGTTCCTGAGTGTTGGCAATGAACTCAAACTAATCCAGCTCCTCCCAGTGGTTTAAGATGTTAATACCATTGTAAAGCCACTTCAATCCTATAGTTAATCTTGAGTAAACAGGTATTTTTGCTGCTTTTCTTATATGAAGGAGATGCTACTAATTGACCATCAAAAGAACATGTTTTGAGGTCCTCCCCAAACCCTGATGAACAGTTAGAATACACCAGCTATGATGTTGTACCAGTTCTAGTGTCTTAACAGACAATTTGAAAAGAGATTTAAAAAAAAAATTTAGGTAAGGACAATAAAAATGGAATTCAATTACAAAACGAGTATGAGAGAATGGTATAATTCTTCAGTAGTTTATATTAAACACTTTGGAATGTACTATGAACTTCCTCCATTAGAGCTGCCATCATATAACTGGTTGAGATTAAAGAATCAGTCTATTCGAGCCTCAAAAATGGCCATATAAAGTAGATCTCATTATTGTATTTAACATGAAGAATCTAAGGCTGTGTGACTGGACAGAAAATTGAGTTGTTAGGAACCAAACTCAGATTTTCTGGTTTCAAATCATCAACTCTTTGTTTTACGACGCCAGGTCCTTTGAAGCCTAGACACCTACTGAGTAATGGGGAAATCTCATCGAGATTTGAA