Transcript asmbl_39885

Sequence
Transcript Sequence for observation asmbl_39885 of TGE0010302:
ATAGGAGTCCAGACTAAGGTTGAACTCGGTCCTCTTCTCCTCACTGCAACCTCTATTTAGGACCTGAAGAAATATTTCGACAGCTGCAATGGTGACCTGGACCCTGAGATTGTGAAGTCATTCCTCTTCCAGCTGCTGAAAGGCCTGGGATTCTGTCACAGCCGCAACGTGCTACATAGGGACCTGAAGCCCCAGAACCTGCTCATAAACAGGAATGGGGAGTTGAAATTGGCTGATTTTGGCCTGGCCCGAGCCTTTGGTATCCCCGTCCGCTGCTACTCTGCTGAGGTGGTCACGCTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCTAATGCAGGACGACCTCTCTTCCCTGGCAATGATGTGGATGACCAGCTGAAGAGGATCTTCCGACTGCTAGGGACACCGACTGAGGAACAATGGCCTGCCATGACCAAGCTGCCAGACTATAAGCCCTACCCAATGTACCCAGCTACAACATCCTTGGTGAACGTCGTGCCCAAGCTCAATGCCACGGGGAGGGACCTGTTGCAGAACCTATTGAAGTGTAACCCTGTGCAGCGCATCTCAGCAGAGGAGGCCTTGCAGCACCCCTACTTCTCTGACTTCTGTCCCCCATAGGCTCTCTGAACCCCAGTGGCCAGGCTGGGGCCTGGCCTGTTTAAGCCTCCCTCCCAGGAGGGTGGAAGAGTCGGGTGTGGGATGCTGAGCGCCAGCTGTGCTGGGCCAGC