Transcript asmbl_52638

Sequence
Transcript Sequence for observation asmbl_52638 of TGE0006234:
CGACGGCAGGCCGTAGGGCGGTCGGAGGGTTTCCGGTTCCGGTGTAACGTTCGGGCTCCGTCTCAGGGGCTGAAGTTTGTGGGGTGCGGTATTGAATCCTGTTTGAGCTGTCCTCCTTTTCCTGCAGAATGGCACTGTCTAAGAGGGAGCTGGATGAGCTGAAACCATGGATCGAGAAGACAGTGAAGAGGGTGCTGGGTTTCTCAGAGCCCACGGTGGTCACAGCAGCACTGAACTGTGTGGGGAAGGGCATGGACAAGAAGAAGGCAGCTGACCATCTGAAACCTTTTCTTGATGATTCTACTCTCCGATTTGTGGACAAACTGTTTGAGGCTGTGGAGGAAGGCCGAAGCTCTAGGCATTCCAAGTCTAGCAGCGACAGGAGCAGAAAACGAGAGCTAAAGGAAGTGTTTGGTGATGACTCTGAGATCTCGAAGGAATCATCAGGAGTAAAGAAGCGACGGATACCCCGTTTTGAGGAGGTGGAAGAGGAGCCAGAAGTGATCCCAGGGCCTCCCTCAGAGAGCCCTGGCATGCTCACTAAACTCCAGATCAAACAGATGATGGAGGCAGCAACACGACAAATAGAGGAGAGAAAAAAACAACTGAGCTTCATTAGCCCCCCTACACCTCAGCCAAAGACTACTTCTTCCTCCCAACCAGAGCGACTTCCAATTGGCAACACTATTCAGCCTTCCCAGGCAGCCACTTTCATGAATGATGCCATTGAGAAGGCAAGGAAAGCAGCTGAACTACAAGCCCGCATCCAGGCCCAGCTGGCACTGAAGCCAGGGCTCATAGGCAATGCCAACATGGTGGGCCTGGCCAATCTTCATGCCATGGGCATTGCTCCCCCAAAGGTGGAGTTAAAAGATCAAACTAAACCTACACCACTGATTCTCGACGAGCAAGGTCGCACTGTAGATGCAACAGGCAAAGAGATTGAGCTGACACACCGCATGCCCACTCTGAAGGCCAATATTCGTGCTGTGAAGCGGGAACAATTCAAGCAACAGCTGAAAGAAAAGCCATCAGAAGACATGGAGTCCAATACCTTTTTTGACCCCCGAGTCTCAATTGCCCCTTCCCAGCGCCAGAGACGCACTTTTAAATTCCATGACAAGGGCAAATTTGAGAAGATTGCCCAACGATTACGGACAAAGGCTCAACTGGAAAAGCTGCAGGCAGAGATCTCACAGGCAGCTCGAAAAACAGGCATCCATACTTCAACTAGGCTAGCCCTCATTGCTCCTAAGAAGGAATTAAAGGAAGGAGATATCCCTGAAATTGAGTGGTGGGACTCTTATATCATCCCCAATGGCTTTGACCTTACAGAGCAAAATCCCAAGAGAGAAGATTACTTTGGAATCACAAATCTTGTTGAACATCCGGCCCAGCTCAACCCTCCAGTTGACAATGACACACCAGTTACCCTGGGAGTATATCTTACCAAGAAGGAACAGAAGAAGCTTCGAAGGCAGACAAGGAGAGAAGCACAGAAGGAACTCCAAGAGAAAGTCAGGCTGGGCCTGATGCCTCCTCCAGAACCCAAAGTGAGAATTTCTAATTTGATGCGAGTGTTAGGAACAGAAGCTGTTCAAGACCCCACGAAGGTAGAAGCCCATGTCAGAGCTCAGATGGCAAAAAGACAGAAAGCGCATGAAGAGGCCAACGCTGCCCGAAAACTTACAGCAGAACAGAGAAAGGTCAAGAAAATTAAAAAGCTTAAAGAAGACATTTCACAGGGGGTACACATATCTGTATATAGAGTTCGAAATTTGAGCAACCCAGCCAAGAAGTTCAAGATTGAGGCCAATGCTGGGCAGCTGTACCTGACAGGGGTGGTGGTACTGCACAAGGATGTCAACGTGGTAGTAGTGGAAGGGGGCCCCAAGTCCCAGAAGAAATTTAAGCGTCTTATGCTGCATCGGATAAAGTGGGATGAACAGACATCTAACACAAAGGGAGATGATGATGAGGAATCCGATGAGGAAGCTGTGAAGAAAACCAACAAATGTGTACTAGTCTGGGAGGGTACAGCCAAAGACCGGAGCTTTGGGGATATGAAGTTCAAACAGTGCCCTACGGAGAACATGGCTCGGGAGCATTTCAAAAAGCACGGGGCCGAACACTACTGGGACCTTGCGCTGAGCGAATCCGTGTTGGAGTCCACCGACTGAGGCCGCCGCGGGCCCTGGCCTCTGCCCGCTGGCCTGCGTCTCTTCAGTCCTCCCCCTCGTTCTCCTTCCCAGCCCAGCCCCCCGTGTGTGTGATCTGAGAACTGTGCCACGCCGACATCGGGACAGAAGGAGAGCACTGGCTCCCCTCCCGTCAGCCTGGTGCTGCCCTTTCCTCTATGTGCATACGATTAAAGAGTTATTTTTAAAGGTGGTATGATATTTTTCACACACTCATAGGATTGGAGTTTGGGTCTTCAGGTGATCCTTTCTCCAGACTTGTAGCAATTGCTGTGGGAAAAAAAATTTGTCATTGGTATTTATGTATATATGAGTGGGTGGAAGGAAGGATGGATTTGTGTTTTTGAGGGCTAATGGACATTTCTGACCTCATCTTCGAGCAAGAGTGATAAATACTGTTTCTTGGAGCAGAGTGAAGCAGGAAGAGGTGTTAAGTGGGTGAGGGACAGGGGACAGATGATGTCCAGCCCCAGCCTTCTATAGAGTCATGAGGTAGACAGATCACCTCTGGTCTCGGCTAAGACTCTAACAGGAAGTCACTTCCTCAGGCAGGGTACACATGAGAATGTGTGTTGTGGACGAGGTGGACACGGGACGTCCAAGGAGGGTGCTGCGGAT