Transcript asmbl_52533

Sequence
Transcript Sequence for observation asmbl_52533 of TGE0006217:
CGACCATCTTGCTCCTGCCCCTGACAGACTCTGTTCCAGGTCAGTGGGACGCTAAGACCGCCGAGTGACCCCTCGCTGACCATGTTGTCCCGGGTGGTACTTTCTGCCGCCGCCACAGCAGCCCCCTCTCTGAAAAACGCAGCCCTCCTCGGTCCAGGAGTATTGCAGGCAACAAGGATCTTTCACACTGGGCAGCCGAGTCTTGCCCCTGTACCACCTCTTCCTGAATATGGAGGGAAAGTTCGTCATGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCCAAAACCGGTGTAACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTTCTGTCCAAAGAAATATATGTGGTTACCCCAGAGACCATCTCTGCCATATCAACAATAGGGTTGCTTGTCTATGTAATTAAAAAATATGGTGCCTCTATTGGGGAATTTGCTGATAAACTCAATGAGCAAAAAATTGCCCAACTAGAAGAAGTGAAGCAGGCTTCCATCAAATACATCCAGGATGCAATTGATACGGAGAAGTCACAGCAGGCACTGGTTCAAAAACGTCATTACCTTTTTGATGTCCAGAGGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACAAGGAGGTAAAGAGTCGCCTGGACTACCATATCTCTGTGCAGAATATGATGCGTCGAAAGGAGCAAGAACACATGATAAACTGGGTGGAGAAGCACGTGGTACAGAGCATCTCTGCACAGCAGGAAAAGGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGCTTGCAAAGAAGGCCCAAGCACAGCCAGTTCTGTAAATGCGTCTATCCTGATCCAGACAGCTAGAAACAGTTGACTGACTAAATGGAAGCTAGCCTATGGGACAGAATCTTTCTGTACTGCGTTCTACTGAAGTTTCATTTCATCTTACCTGAAAATGAAAAGCTTGGGTTCATATAGAAAGAGAATTAAAACAATATTTTGGTCAGTGAGATGCTTCTTGTCCTTCTTGCTCTGCATTTTAAGTTGGTCCATGATCACTTTTGATTCAGCAGTTTGCTTTTAATAGAATTTAGTGCCTGACTAGAGACTACCAAG