Transcript asmbl_52242

Sequence
Transcript Sequence for observation asmbl_52242 of TGE0006193:
GGGGCCTTTTTTCCCCCCGGAGCTGTGCTTGGCCTGTAGGTCTGTGACGAGCCGCGAACGCGGGTCTCTCTGTTCCGCAGGATGGGGTTTGTTAAAGTTGTCAAGAATAAGGCCTACTTCAAGAGATACCAAGTGAAATTCAGAAGACGACGAGAGGGTAAAACTGATTACTATGCCCGAAAACGTTTGGTAATCCAGGATAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTCGTGTAACCAACAGAGATATCATTTGTCAGATTGCTTATGCCCGTATAGAAGGAGATATGATAGTTTGTGCAGCTTATGCTCATGAACTTCCAAAGTACGGTGTGAAGGTTGGCCTGACAAATTATGCTGCAGCATATTGTACTGGCCTGCTGCTGGCCCGCAGGCTTCTCAATAGATTTGGCATGGACAAAATCTATGAAGGCCAAGTGGAGGTGACCGGAGATGAATACAATGTGGAAAGCATTGATGGTCAACCTGGTGCCTTTACCTGCTATTTGGATGCAGGGCTTGCAAGAACTACTACTGGAAATAAAGTTTTTGGGGCCCTGAAGGGAGCTGTGGATGGAGGCTTGTCTATTCCTCACAGTACCAAACGATTCCCTGGCTATGATTCAGAAAGCAAGGAATTCAATGCAGAAGTACATCGGAAGCACATCATGGGTCAGAACGTTGCAGATTACATGCGTTACCTAATGGAAGAAGATGAAGACGCTTATAAGAAACAGTTCTCTCAATACATAAAGAACAACGTAACTCCAGACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATACGAGAGAATCCAGTCTATGAGAAGAAGCCTAAGAAGGAAGTTAAAAAGAAGAGGTGGAACCGTCCCAAAATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAGAAGAAGGCAAGCTTCCTCAGAGCTCAGGAACGGGCTGCTGAGAGCTAATAAACCAAACTGAAATTTTCTATTAAGATTTTTCATATAAAGATAGTAATAAACTTATTGAATCTGC