Transcript asmbl_52188

Sequence
Transcript Sequence for observation asmbl_52188 of TGE0006181:
AACTATACCCAGGAACGGGCGCAGTTTCCTTTTCGTCTTTAGACATGGGCACACCACAGAAGGATGTTATCATCAAGTCAGATGCACCCGACACCCTATTATTGGAGAAGCATGCAGATTATATCGCATCCTATGGCTCAAAGAAAGATGATTATGTATGTATGGTTTTATGTTAAAAGCTTATTTTAAAGAAGTCAGACCATTCGGCATCATCGGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACTGTAATGGATCTTATGGGACAACTGCATCGCATGAATAGAGAAGAAATTCTCACATTTATTAAGTCATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATTGGACATGATCCTCATCTTCTGTACACTCTGAGTGCTGTCCAGATTCTTACTCTGTATGATAGTATTAATGTTATCGACGTAAATAAAGTTGTAGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGCTGGAGATATTTGGGGAGAAATTGATACAAGATTCTCTTTTTGTGCGGTGGCAACTTTGGCTCTATTGGGAAAGCTGGATGCTATTAATGTGGAAAAGGCAATTGAATTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGTAGGCCAGGTTCTGAATCTCATGCTGGGCAGATCTATTGTTGCACAGGATTCCTGGCTATTACTAATCAGTTGCATCAAGTAAATTCTGATCTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCTTCAGGTGGACTCAATGGAAGGCCAGAGAAGTTACCAGATGTCTGCTATTCATGGTGGGTGTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTACGTAATTTCATCTTAGCGTGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAGATATGGTTGATCCTTTTCATACTTTATTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACCCGTTAGTCCTGTTTTTTGCATGCCTGAGGAAGTACTTCGGAGAGTGAATGTTCAGCCTGAACTAGTGAGCTAGGTTCACTGATGCATAAGTTGCTCAATATAGTTTTGCCATCTTAACATTTCTGTATTTGAAGTGCTTACCAAACAATATGTTAATATTTTGTATATGTATTGATTTTTAATAAATTGTATAATTATACATATTGTAAAATAAAGGCCTAGTGTGTCTTCAGCTTTTCTGAGTACAATATTTGGTTTATACTTTAATGTATTTATATTCTTTGTAGCAGTAATCTTTAAGAACTATTTAGTTGAAGTCAAGTGTTATACTTGATTTTATCCTGTGCTTCCTTCATATTTTTATGTATGATAGTTCATGTAAATTGGTCTGTGTCAGTGATAATGTTAACTGATAAAAAAAATTGATAAGCCTCATTCTAAATATGAATTAAAAGATTTACAAAAACAAATGGCTGTTGAAATTTGGGAGTATTTCATAGGTTTATGGTTAACTCTGAGTTGGTCACAGTGATTTAGGTAAATGACAGTTCGTCTTAGAATATGATTACAATCGGGACTACACTTTATTCTCATTTTTAACATGTCAAAATGCCAGCTTCTTAAGCGATGGTTGGTCTTTTCCCCTTAATAAGGAGACAAGTAATAGTTGCCACAATATTTTGTGTACCCGTGTTTTCAGAAAGACTAAAATGAGCACAACTATTCTCTAAAAGTTTTTACATTCTTGGTGAAATAAAGTATTTTAATGAACATTTTTTGCGAGGTGAAAGTTGAAATTTTTCTCAAGTGTGTTTGCAATAACCTGTGTCATTTTAAGAGTAGTGTTACACAAGTAATGGTTCACTCAACATTGTTGACCAATAATACATGGTTAAACACCTTGAACGTAGGTGCTTGCATGAAATTCACTAGAGTTTTGACTAAATTGCAGTTTATGAGTTTGGAAGTCTTTGGATGAAACTTAAAATGGTGTCAGAAGTATTTGAAGTTTTGCAAAATGCAGTCATTGCTTGTGGGTGAACTATGTTGTTAAATACCTGCTTTATTGTGAT