Transcript asmbl_52102

Sequence
Transcript Sequence for observation asmbl_52102 of TGE0006178:
GGAAGATGGCGGCGTCCAGGTGGCGGTCTTGAGGAGACCGAACCGGTATGGCTTTGGCGTCGGGCCCCGCAAGGCGGGCGCTTCGTCTACCTGGAAGGCTCGGCTTTGGGGGCGACGGGACCCCGAGACGCGGGGCGTACGAGTGGGGCGTTCGCTCCACGCGGAAGCCCGAGCCTCCTCCCCTGGACAGGGTGTATGAAATCCCTGGACTGGAGCCCATCACCTACGCGGGGAAGATGCACTTCGTGCCCGGTCTGGCGCGGCCGGTCTTTCCGCCGTGGGATCCTGGCTGGACGCACCCAAAGTTCCGCCGCGCGCCCCCGATCCAAGAGCATCCGCTGTACAAGGACCAGGCCTGCTACACCTTCCACCAGCGTTGCCGCCTCCTCGAGGGTGTAAAGCAGGCTCTCTGGCTTACCAAGGCCAAGTTAATAGAAGGCCTTCCTGAGAAAGTGCTTAGCCTTATTGAGGATCCAAGGAACCACATAGAGAACCAAGATGAACGCGTTCTGAATGTGATCTATCACGCCCGTCTCTGGCACTCCACTGAAAACATCCCCAAGAGAACGACCTACTGCCCAATCATTGTGGACAGTCTGTTACAGCTGTGTAAATCCCAGACTTTCAAGCATCCTTCACTAGCCAGGCGGATCTGTGCCAAAAACTACACGTTATCCACCACTTGGAATCGAGAGTCTCTTCTCCTTCAGGTCCGTGGTTCTAGTGGAGCCCGACTGAATGCCAAGGACCTTCTGCCCCCCATTGCCTCCAGAGAGGAGGTAGAAGCTACTAAGAATCATGTTCTTGAAACCTTCTATCCCATATCTCCCACTGTCGATCTTCAGGAATGCAATGTTTATGATGTGAAAGACGACACAGGATACCGGGAGGGTTATCCTTATCCCTATCCCCACACCCTGTATTTTCTGGAGACAGCCAATTCACGACCATACCGCTTTCAACCAGATCAGCTGCGGGCCAAGATGATCCTGTTTGCCTTTGGCAATGCCTTGGCTCAGGCCCGGCTCCTCTATGGGAATGACACTAAGGTTTTGGAGCAGCCAGTAGTTGTGCAGAGTGTGGGCACCGATGGACGTGTCTTCCAGTTCTTGGTGTTACAACTGAACACCACAGATCTGGCCTCTAATGAGGGCATCAAGAATCTGGTGTGGGTGGACTCAGACCAGCTCCTCTATCAGCATTTTTGGTGTCTCCCAGTGATCAAAAAGAAGGTGGTTGTGGAACCTGTTGGGCCGACTGGTTTTCAGCCAGAGACGTTCAAGAAGTTTTTAGCTTTGTATTTGCACGGTGCTGTATGAGCCAAGGACTGTTCTGCAGCCTCACGTACCCCCTCGCTTCAACCCACCGAAGACCCTGCAGCCTGGGCAGGGCCTGGGGTCTGCCCGGAGCCTCAGTGCTCTTTTGGCCTGGTGG