Transcript asmbl_3069

Sequence
Transcript Sequence for observation asmbl_3069 of TGE0043120:
TAAGAGAGTCTCCTGGTTTCTTTGGCCATCTCCTCCCCATCCCCAGATCATTCTGATGCATGCACCAATTTGGTCACATGATATGGCTTGTGCTCCACTTTTGAGCTCTGGGGACACTGTTCCAGGACTGGGCAGCTCAGCGGTGCACCATCTCCTACCGGGCACCTGAACTTTTTTCTGTGCAAAGCCACTGTGTCATCGATGAGCGGACTGATGTCTGGTCCCTAGGCTGTGTGCTTTATGCCATGATGTTTGGGGAAGGCCCTTACGATATGGTGTTCCAGAAGGGTGACAGTGTGGCCCTTGCTGTGCAGAATGAACTCAGCATCCCACAAAGCCCCAGGCATTCTTCAGCATTGCGACAGCTATTGTCTTCTATGATGACTGTGGACCCCCAGCAGAGGCCTCACATCCCTGTCCTCCTCAGTCAGTTGGAGGCATTGCAGCCACCAGCTCCTGGCCAGCACACCACCCAAATCTGATCAAATCAGTGGACATATTGGGAAGATGACCTTGAAGTGGCTTTCATCCCTCATTGGAACTCCTTCCATTCTTCCAGGATGGCTCTCACAGCTAGTGGCAAGGATAGTGGGTCCTTGTATATTCTGCCTTCTTACCCCAATACCTGGGCAAGGAACCTAGGGTGAGTTGGGGGAAAATGAAACAGAAAATATGGCTCAAAGCTAGGCTGCTGGGTGCACATCTCATTCTGTCTCCAGATCTGGGAGCAGGAGAATACATAAAAAGGAGAATAAAGTAAAAACAGACCGTGTATATTTTAGGTCAATGTGTCTGGAGGGAAAGAATGAACTCTCTGCTTGCTATTTCCAAGGGAAGCTCCTGGCAAGAAGTACTGGTATGATGTCTTGAGGTAGATCTACTTCTTGAGTTCTGGCAGCAGGCAGGTCTTTTAAGCTGGCTTAGTCAAAACCAGAGAGCTTCAAGCTTGAGCTGGTTTCTGTCTGTGCCAAGAAGTGGGACCAGGGTCTCCTTGAAAGCACACTCAACCAGTTCTGTCATTCATTCCCAGGGTGGGTAGCTTAGAACAGCCCAGCTCCGCAGGTTTGCCAAGTCCATGTGACCTCTGGGTGGAAGCACACCGGGTCTTTTCCCTTCTTCAGCAGAGGACAAAGGGAGTGGAGCTGGCAGCCATTTTTTTCCAGTTTCCCTGACTATTCTAGCTCACACATGGTTAATAATTGATGAGGCTGGTGGCCTGTGGCAGTACCCAGCAGCCACTTCCTGCCCTATTTGCTGAGTAAACAGGCACCTGCCTTAGTTGGGTTTCAAACTTTCCTCAGGGAAGGGCACTGCTTCCCTGAGTCACCAGGGAGGGGAGACAAGGGCAGGGATGGTGCTCCTGTTCTGGAGATTCCACCCCTACATGCTGACGTCAACATGAGTCCTAGGGTGCCTATTAGTGAAGTATAATTTATCCCTAGGGTCCAGGCAGGAGGCTTCCACCCCGAGCAGAGGCTGAAGCCAAAAGAAAGCACAAACAGAGGGGAGACGACCTGACTTTTAATAGCATGGCTCCAGCCCCAGAAAGCAAGATAGACAGCAAGCTATGCAAAGCTGCCAGAGGTGCTGTGGCACAAACAACTAGATTGCCCTTGTTCCTGCCCATCCCCCAAGTTTGTGAGGTGGCTGTATGCCCGGGAACTTTGGGCCCGCCCAGCCCCCATTCCCAAATCCTCAGTGTTCAATGACGCCTGGGCCAAGCCTTCTAGAGCTGTTGAGTGAAGCAGCAGCAAGAAGAATAAAGTAGTCCAATCATCCAACACAGACTATCAGATATTTCAGAAAGTGAAGACTTGTATCTTGCAATAGCTTGTAGCTAGACAGACAGGTCCAGGGTTTGGTCCTTGTTTCTTTCCTATTCTGCGAGTCCTTAGGACCTTACATTGAAGTCCTTGGGTTCCTGCTTTCTGGGGCTCAATATGGGGCCCCCTTGGCAAGTCTCACTGTCAGCCATGTGAAGGTAAAATTAAAAGGTCACAAGCGGCCAATAGCGGGAGGTAGCAGCCAAAGCAGAAAGGGGGACAAGCAGAGGCTCAAGCAGTTACAAAGGGGACAAGAAACCATGCAAGGAGACTGTTTATTTCGAAAGGATTTTGCAATAAACACAGTGAACAGGCTCCAAGTAGCGGTCTACTCTTCTCCCTCATCCTCGTCCTCATAGGAGTCGATGCCTACTTCCTCATAATCTTTTTCCAGGGCAGCCATATCCTCTCGAGCCTCAGAGAACTCCCCCTCCTCCATTCCCTCACCCACATACCAGTGTACAAAAGCCCTCTTGGCATACATCAAGTCAAACTTGTGGTCCAGACGGGCCCAGGCTTCAGCAATGGCGGTTGTGTTGCTCAGCATGCACACAGCACGCTGCACCTTGGCCAGGTCACCCCCAGGCACCACAGTGGGTGGTTGGTAGTTGATGCCAACCTTGAAGCCTGTGGGGCACCAGTCCACAAACTGGATGCTGCGCTTCGTCTTGATGGCAGCTATGGCAGCATTCACATCTTTGGGCACCACATCTCCACGGTACAGCAGGCAGCAGGCCATGTACTTGCCGTGCCGAGGGTCACATTTCACCATCTGGTTGGCAGGCTCAAAACAGGCATTGGTGATCTCTGCCAC