Transcript asmbl_52046

Sequence
Transcript Sequence for observation asmbl_52046 of TGE0006166:
GATCCTGGCATATAAGAGGGCCCAGCCGCGCGGGGTCTCCAATCTGCCATTTTCTGTTTCCGAATAAGTCTCTTGTGTCCCAAATTTCCTCTGTTTTCTTCACAGGCTATAGTCCGTCCGTTGGCTCACCACCTCAGGGGAACGATGGCCGCAGAGTCAACAGCCACTGCCGCCATCGCCGCGGAGCTGGTTTCTGCCGACAAAATTGAAGAAGATGCTCCTGCTCCTTCTACCTCAGCAGATAAAGTAGAGAGTCTGGATGTGGATAGTGAAGCTAAGAAGCTATTGGGTTTAGGACAGAAACATCTGGTGATGGGGGATATTCCAGCAGCTGTCAATGCATTCCAGGAAGCAGCTAGCCTTTTAGGTAAGAAGTATGGAGAGACAGCTAATGAGTGTGGAGAAGCTTTCTTTTTCTATGGGAAATCACTTCTAGAGTTGGCAAGAATGGAGAATGGTGTGTTGGGAAATGCCCTTGAAGGTGTACATGTGGAAGAAGAGGAAGGAGAGAAAACAGGAGAAGAATCTCTGGTAGAAAATAATGATAACATAGATGAAACCGAGGGCTCAGAAGAGGAAGATAAAGAAAATGACAAGGCTGAAGAAGCACCAAATGATTCAGTTCTTGAAAACAAGTCTCTTCAAGAAAATGAAGAGGAGGAGATTGGGAACCTAGAGCTTGCCTGGGATATGCTGGATTTAGCAAAGATAATTTTTAAAAGGCAAGAAACAAAAGAAGCTCAGCTCTATGCTGCACAGGCACATCTTAAACTTGGAGAAGTTAGTGTTGAATCTGAGAATTATGTCCAAGCTGTGGAGGAGTTCCAGGCTTGCTTAAACCTGCAAGAGCAGTATCTGGATGCCCATGACCGTCTCCTTGCAGAGACCCACTACCAGCTAGGCTTGGCCTATGGATACAACTCTCAGTATGATGAGGCAGTGGCACAGTTCAGCAAATCTATTGAAGTCATTGAGAAGAGAATGGCTGTACTAAACGAGCAGATGAAGGAGGCTGAAGGATCACCTATTGAATATGAGAAAGAAATTGAGGAGCTGAAGGAACTGCTACCTGAAATTAGAGAGAAAATAGAAGATGCAAAGGAGTCCCAGCGTAGTGGGAATGTAGCTGAATTGGCTCTGAAAGCAACTCTGGTAGAGAGCTCTACTTCAGGTTTCACTCCTAGTGGAGGAGGCTCTTCAGTGTCCATGATTGCCAGTAGAAAGCCAACAGATGGTGCTTCCTCATCAAATTGTGTGACTGATATTTCTCACCTTGTCAGAAAGAAGAGGAAACCAGAAGAAGAGAGCCCCCGAAAAGATGATGCAAAGAAAGCCAAACAAGAGTTGGAAGTGAATGGAGGCAGTGGGGATGCGGTCTCCAGTGGAAATGAAGTTTCGGAAAACATGGAGGAGGAGGTGGGCAGTTAAGCAGGGCTTGGACTCTTGCCTCATTTCCCCTTGTTCTCAGGCCTGGGGAAACCAGTCCTCCCAAGTGCATGTTCTCACCTTGAGCCTGTTTGGATTGCTTGAGTGCAACAGGAAACAGTTTGGTTATGGAATGTAGGACGTCTCACTGACAAATGTAAACTTTATACATAGCACACAGGTCCCCCTCTAATGAATGTAGGGGAAGATACTTAATGGCAAAACCATTGGGTCACTTCTGCTTGCTCTTTTCCATGTTTGAACATTGGCTCTGCCAGCCCTGTTAGAGAATTTAAGAAATGGCTTTTATATTTTGGTCATTGCCGTGTTAGTGTAAGGAGCAAAGTGGAGTTGAGGGGACCTGTGTTTACTTCCTCTGACTGAAGCCTACTCGTTGTAAAAGATAGAATGGCTTAAAGTAGGGTCACTTATGCCCAGGCTCCCTGTTTATCTTCCAGGCTGAGAATCAGGCTGAAAGCCGGGCAGCAGTGGAGGGGACAGTGGAGGCTGGAGCTACAGTTGAAAGCACTGCATGTTAAGAGGGAGCAGAGCCTTCCTCCCAAGGGAAAGTGTTTTGTATATAATGTATTTTTTCACTTTTGGGGGATTCTTTTTGTATAACTTCAATAAAGATTGTAAGCAAAGGTTGAGGCTTTGATTTTTTTTTCCCCTCTTAAGTATTGGCTGAATCTGTGCCTTGGAGCACTTGTGTTTTATATAGTGGCCAAAGGTACTCCCCACTCTGTACTATCTCTGGAAAGTTATAATAATCCAAATTCCTGTCTGTTTAATGTGGAGGTGATCAGGTGTGGTTGCCAGCCCTTTGTCTTTCAATGGTGCTATTTTTGTTTTAAATACTTGACTGAACCCAGCTGTCTTGCAAACTTTCAGTGGTGCTGTCCCTGGATGGGAGCTATAAAAACAAGACTTGGTGAAGATCTTGCTCTTTGGTGCTGATACTGTATGATGGACTCTGAGCTGATAACAGCCTCTAAGCCAAGTCTTGAATGGTACCAAGTAGTCTCCAACTGGGGCCATACTCCTGTTCTAGTAAAAGAACTCTGAGGAAGACTTGGGGGTGGGGTAGTCCTTGAGGAAAACTGGTGTGCTCATTGTAGAGAATTGAGATTTCTGGTTTGAAAGTGGCTAAGGGACTGACTACAGTGGACACTTGGATGTGGTTGGAAGAATCTGGGGAGGCTGGCTGGTTGAGTTATATTATTTTCTGTACAAAGAAAGTTGAAATATATCAACGCTAAACTGTTACCTGTCTGCAGTTTTGACTTCTCAAATAAAGATGTTATAAAAA