Transcript asmbl_29127

Sequence
Transcript Sequence for observation asmbl_29127 of TGE0006790:
TGCTTGCGGCTCCGGGAGACCCCGGGTGTTTGTGTGTGTGTATGTGTTGGTGACTGTGAGTACGGAGGAGCAGCGGCCGCCATTTCAGGGAGCTAGCCGACGCTGTCGCAGGGGTGGATCCTGAGCTGCCGAAGCCGCTGCCCTGCTCTCCGTCGCGGGCTCCTTTAATCCCATTGTTTCTTTTAGATTCGCTTGGGCCTAGACGCCCTCGGGGCCCGATATTCGGGTTGGGCGGTACCGCGGCCTGGGCCTAGTGGCTTAACAGTAGCGACAGCAGCAGCGGCGGCGGCGGCGGCAGCCGACTTCCCGTGGCGAGCACAGGCGCGCGGAAGCCCGCACAGGCGAGTAGAGAAAATGGCAGACGATATTGATATTGAAGCCATGCTTGAGGCCCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAACAGTGCTAACGGCCATGAAGAACGTAGCAAAAAGAGAAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAGAGAAAAAGAAGCAAAAGTAAAGAACGGAAAAGAAGTAGAGATAGAGAAAGGAAAAAGAGCAAAAGTCGAGAGCGGAAACGAAGTAGAAGCAAAGAAAGGAGACGAAGCCGCTCACGCAGTCGGGATAGAAGATTCCGAGGCCGCTACAGAAGTCCCTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGATTGCCTCATAGCATCAAATTAAGCAGAAGACGTTCCCGAAGCAAAAGTCCATTTAGGAAAGACAAGAGCCCTGTGAGGGAACCTATTGATAATCTCACTCCTGAGGAAAGGGATGCAAGGACTGTTTTCTGCATGCAACTGGCAGCAAGAATTCGACCGAGAGATTTGGAAGAGTTTTTCTCTACAGTTGGAAAGGTTCGAGATGTGAGAATGATTTCTGATAGAAATTCAAGACGTTCCAAAGGAATTGCATATGTGGAATTTGTTGATGTCAGTTCAGTGCCTCTAGCAATTGGATTAACTGGCCAACGAGTTTTAGGAGTGCCAATCATAGTTCAGGCATCACAGGCAGAAAAAAACAGAGCTGCTGCAATGGCAAACAATTTACAAAAGGGAAGTGCTGGACCTATGAGGCTCTATGTAGGCTCATTACACTTTAACATAACTGAAGACATGCTTCGGGGGATCTTTGAACCTTTTGGAAGGATTGAAAGTATTCAGCTCATGATGGATAGTGAAACTGGCCGATCTAAGGGATATGGATTTATTACATTTTCTGACTCAGAATGTGCCAAAAAGGCTTTGGAACAACTGAATGGATTTGAGTTAGCTGGGAGACCAATGAAAGTTGGTCACGTTACTGAACGAACTGATGCTTCGAGTGCTAGTTCATTTTTGGACAGTGACGAACTAGAAAGGACTGGAATTGACTTGGGAACAACTGGACGTCTTCAGTTAATGGCAAGACTTGCGGAGGGTACCGGTTTGCAGATTCCACCTGCCGCACAACAAGCATTACAAATGAGTGGCTCTCTGGCATTTGGTGCTGTGGCAGATTTGCAAACACGACTTTCCCAACAGACCGAAGCCTCAGCTTTAGCTGCAGCTGCGTCTGTTCAACCTCTTGCAACACAGTGTTTCCAACTTTCTAACATGTTTAATCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTCATTGAAGAATGTAATAAACATGGAGGAGTCATTCATATTTATGTTGATAAAAATTCAGCTCAGGGCAATGTGTATGTGAAGTGCCCATCTATTGCTGCGGCTATTGCTGCTGTCAATGCATTGCATGGCAGATGGTTTGCTGGTAAAATGATAACAGCAGCGTATGTACCTCTTCCAACTTACCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATACAGTCCCTTATGTATATAGCTTTTTTTTCTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAACTCCTGTTACCTTGAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTATCCCTAACTAGCAAATCCTACTTTATGCAAAGCTGTTCTCTTGTTCTGCTGTTTTAAATGTCCATGTAGAAAATGACATTAAGGATCTATAGAATAGCTCTAGGGGAACAAATGTGCTTTCTGTATAAAGGCAGACAGGTCACGTTTTAATGTTTCAGAAACCTAACTTTTTACACAGCAGTTACAATTCACATTCATGTATTTGGCTCATGGTTCAGCAAAGGTTTCCAGAATCCACATTTAGTGTGTGAAAAGTCTAAGTGGCTGTATGGCTGCTTGGCATTTGATCTTGATTATTTGGCAAGAATGGGATTTCAAAATAATATTTCTCGATGGTAATTTTTTCAATTAATGTCTCTGTAAAAGTTTCTTTGTAAATACTGTATGTTTTAGTGTGTCTTGAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGGTGGCTGACGTAACAGATTGAGTAAGCAGTCTTGGGCAAGAGATGGGAAATGCAGAAAAAGGTTTTGTCTGGTTGCATATAATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTGAAAAAGGCCACAAGAAAA