Transcript asmbl_51943

Sequence
Transcript Sequence for observation asmbl_51943 of TGE0006146:
AGGTGGAGGAGGAGAGGTCGGAGCCGTCTCCAGGAGCCCTTAGAGACCGAGTCCCCGGCGGCGGCGGCGGGGCAGCGCACGGGCGGACTAGTGAGCACCGAGGGGCAGGCGCAGGAGATTCATTCTCCCCACTTGAAACCTGAAAAGAGTGGGCCACACAAAGTCTTACTGGTTCCAGGTGAAAACAGTAACTGAAGATGTCAAGCAAAACAGCAAGCACCAACAACATCACCCAGGCACGGAGAACTGTGCAGCAGTTAAGACTAGAAGCCTCCATTGAAAGAATAAAGGTTTCAAAGGCCTCAGCGGACCTCATGTCCTACTGTGAGGAGCATGCCAGGAATGACCCTTTGCTGATAGGGATACCTACTTCAGAAAACCCTTTCAAGGATAAAAAAACTTGCATCATCTTATAGAGGAGTGAAATGGTTCCTCACGTCTTCTCAACAAAGCAAATTATGAGCAGCTCCTTGAAGAGAATTACCTTCAGCTTATTTGGTAACCACTGCTAATAACTAAAATGCTCTTAACATGGAATAATAGACTCTGAAGTCTTTATTTTCCAACTTGTCCTTTCTCTGAAATACCCTTTACTGATTTAATACAATCCCATTTTCCATTTGGCAACTGTGGTGTCATATTGGGTTACTGATTAAGGAAAGTCAGTCCGGGCCCTTTAAAAAACTCAGTTATATACTTTTAAATATATGAATGATCCAGTTATATCAAGACCTAAATTAACTAAGCCCCTATCTAGATTAAAATGCCAAGAGTAATTTAAGTCCTTAAACCTTTATATCATAATGTGTTCTTAATAGGGTTGTGCCAACCTGTACAGTATACACGGGTGAGGAGTGTTTTGTGTATATATGTATGTCTTTGTATATACACATCTCAAAGCTTATTTCCTTATTAAAATTTCTCTCTCTCCATACCATCAGTTAAATCCACAAGTTATACCTTTATCTTAAGCTGTGTGTAGGTAGAATAAGAACTTCTTTTCATATAGTTATTGTACAAAAAGTAAAGGACATCCTAAAGGTCGTATTCATTGTAATCAAATAATGAAGTCATCTCTTGCTGACCCTCTAGTCTACAATAAACTGTGCCAATTAAAATTTTAAAACTCAGCTAAAAGCCCTTTTATAATATGATATTCATTCACCAGGGGCCTTTTCGGGCTTCAGTGATCCTGAGTCTAAAAAAAGGGGAGGACAGTGGGCAGCTGTGTCCCCAGGGCTCACATTCTCTGGATTAGGGGTTACATCTCTGAAGTTTTCACCCTAATGATGGGGATGAAACAGAGTACACAGGAGGCTGGCCGAGAGTTTTTTTTCCTGTTCTTGGCCGAACTTTATGATTTAGCTCTTTTTCTCTCTGCCTTTCCTATATCTTTCCTCTCCTGCTAGAAAATCTATTCCAGCCCCAAGTGGGTGGAACATGGTGGGAAAGAAACATACAAAATCATAAAGGTATCAAGACACAAGCTCTTTTCAAATATCTTCAGTGTCAGCCTCATCCCTACCTTGTCCCCGAACCATCCAAGAGAGGCTTGGTTTCAGTGGTACAGAATTTGGGCCCAAGGGTCCCAGGAGCTGGACATTGGGTTCCTTGATTTTCCTCTGGACACGAATGTAGCCCTCACATCCTCGGGATTTCCAGTGGGTATCCCAAAAGAAGGAATCTCCTATGACCAGAGAGTATTTTAACTTTATCAAAGAAGAAGACAGGTTATTTTTCTTAAATGCTCATTTAAGGGCCCAAAACATACACTTGGCCTATAATATTTTAATTCATCTTCAGTTCGTTAAAAATAACGACAAATGATGAAGGGTTAAAAATGTATTCTCAAAGAGGATTCAAGCCCAAGAAGGAATTATTTACAGTGGTTTTCCCTAGTTCTGTACAATCTCGCCCTGCAGTGCAAGCCCCTTTTAAAATCTAATGTCTGAGCTTTGGATAGTATGCTAATTTGAGTGAACAAATGCAGTACTATTTTTAAACTGCTCAAATATATTCAGTATTTCTCCAACTCACCTATCTATTCGGCATTGTGAACTGCCCTCATATTTCTAAGACTGGGTGAAAATCATGGCACTGCCCTTAACTTCTTGTCATCTACTGCTTGGTTCAGCAATATGCCCAATTCCCAAGTAAATTATAGTTACCTGTTTAGGAGAGAGAAAGATTTTACCTTTCAGAAGGTGAAATTTGAAATGTATGCTAAAAAGATGACTTTACCTTTAATGATTAACTTAAGGAGATATTCTTTTTTAAAATAAATATATTTTTCTGATAGTTTCAGAACACTAATCTTATTTTCACTCCGATGTTTAACATGTTTCTTTAAATATTTATAATGCATCTTGTTACAAAGTATTTTCATGAAATTATGTTTATTATATTGTTATGTGCACAGTTTTTGGTAGCAAGCATAGTACTAAAACATGTTCTTTTACCTAACAGAAAACAAATATGTTTTGCTATATATTTGTTAATATGCTTAAAGTGGTAAGGAATGGACTTGAGGTCCCAGGAGATTTCATTTTATTTTTGCTGGCCAGGTATCCATTAAGGCCATGAATATAAATGTCGTGTAACTTCCTAACCAGGTGTGGGGCATGTTTAAGAAAAGTGAAATCAAATCCTTTGATGCTGGACCCAAGAGGGGAAAAATTGTAGTTAAATGTTGATTTACTTATAACTAGACATCTGTGTGAGAAAATATATGTATACACATATATGATATGCAGAAGTCACTATTTATCAGGCTTTATTCTACTTACAAAGCCACAGTTTGACTGTTCTGCAGCAGCTGGTTTATGACAATGGTGGACAAATGCCCAGTGCGTGTTAATTTTTCCAGCTACCATCATAATGACATAATCACGTATATATATGCAGCCATTTAAATATTTTCACTGTACTTTATCTTTAATGCTGCTTCTGTTAACAGTGATTTTTTTTTTCATTTTTATATTTTTATTAGTTCATCATAATCCTGTCCATTGAGGCCTCAGGACCATGGCAAGATATGCTATACAAAATTTCATGACTCCAAAGAATTTTACAGAACATTTTTTTTTCTATAAACACTTCATATACCAGGTGGTTCACAGGTTATAGGTAGTAACTACTTTTTTTCTAAAAAGAATCAGGTTTTTACATTTCCTTGCCCTACTGAAATAAAAAGTGCCATACTTATCTTTTAAAGGAAGGACTTGATTTGCTTTCTCTCTGGACTATTTTTGTACTTTACTAATCTAAACTATCAGAAAATACAAGTCTACCAATGATTTCGTAATTTTGAGACATAGGTTAGTTTAGGTAGAGGAGGATGTGCCAAACTTTTTCTTCAGATGCTTTCTTCTCAACCAATTTACAACTAAGATAGTGTCCTCTAAGTGATTACTCTGAATTTTGATTTAAAGTCTATATAGGCCCAAGAAGTGAATTATACTACATATCATTCTTTTCTCAATAAAATATAATACAGTATGTGTTAGGAATTGTGTTGATTTCCTTTATGGTATATCTGTTAATAGGAAAAAGTACATTGAATCAAATAGAAGTATATGTGTATTAAAACAGAGCACTTACCTAAAATTGGGCGGCCTGGATCTTAGCCCTAGATCATTTTCTAGCCAATCCTGTGTCCCTGTGTTGTGACTTTGGACAAGGCACTTGCTCTCTCTGGGCCTTCATTGCACCATCTGTAAAACAAGGGGCTTGAAGTAGATGGTGGCTGAGATCCCTTCCTGCTTTCAGATGTCTCGTTCCAATGGCCTACACCCCTACTGGTCCTGCCAACGTGTTGGTGCTATAAGCTGCTTCAAATATAAAATTGGTTTGTCTGTCATGTATGCTCATTTAATAGCTTATGAAAGGCCTTTTTGTCATACAGCTTTTTATTTCTAGTTTTACGGACTTGATTACTGTAATAATGTCTTGTTTTTAGTCATGTAACTATAAACATATACTCTCTTGATGTCTCAGTAAATTTGCATTTGATAAATATAGTTGATGGGATTTTGTTATTTTATAACATTCTTTGGCTACTCATCTGTCCAGCATCTTATTTACCTAAACACTGTGATCATTGTTTGGAAATCTGTCCTATGGAAAGAATAAAAGCATTTACTTCACAGCTAATATGTTCACAGATTTGAAAGAAGTTTCATTAAAGCACCATTACTCTCTTTA