Transcript asmbl_27848

Sequence
Transcript Sequence for observation asmbl_27848 of TGE0032891:
GAATTTTGCGGGCGGTCACACACTTGGAACGTTTAGTCGGGCCTTTGGATTTCCCTAGTGTCTGTAATCACGCCGGGATCTCTTCTAATGGAACTCATTTGGTCAATGGCCTCACTATCCTCACATCATTCCTTTTTTTAGTTTGCGGTACTTCTGGAAACTGAAAACTAGCACAGGAGAATAGATGGGACTAGTAAAAACAGCAAAACCCACATCCCTGCGAGCTTCTTGCTTACGAAATCGATGCTCTAATCATTTATTTTGATCCCATTCTACTGCTTCAGTTTCTCTTTCATTTAACAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGTGGATTTCCATTTTGTTTCCTGTTCTGCACAAGTTCTTTGCTCCTTAGACCATCTGCATCGTTTATTGTCTGTCCCCTAGTGTATTTGTATGGCTTACAATCTGAGAACATTCATCGACTGTGGGTGGAATCAACTGTATTTGTGGCATAGATTTAATGGGGTGTTATTAAATGTTCTCAGACACAGAGGAGAGGGCCGGTGAAGGGTGAGAGAGTAAGGACAGGCAAACAGGAATCTTCTGTAGTATCTTCAGATGCTTTTGTTTTGCTTAGTGGGATTTTTTTTTCTTTTAATTATAAATTGAGCCCAAGTATATTTACATTAAAGATTTGAAATTAGCTGGGTGTGGTGGCGCACACGTTTAGTCCCAGCACTTGGGGGAGTCAGGCAGATTTCTGAGTTTGA