Transcript asmbl_27847

Sequence
Transcript Sequence for observation asmbl_27847 of TGE0032891:
CTGTGCTCCTGCAACTTAAACCGAATTCCTGGAGGAGTCTTCCGGCTTGGGCCTCCGCTGTGGTGCGGTTGTTGGGCACAATGCTTCCGGCCTCTTGTGCCTCACTTGTGGACTGGAGACTCAGGCCTCACTCACTTCGGTTCCTCAATTAACAGCAGAACCATCAACAAATGTTTGTTGGATAAGGACAAATAAAGAGATTGGAAAGGAGCGAAGCCTTTTTGACTTGTTTCACTTGTTCCCGCCTACTCCATCTTCTTCCAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGTGGATTTCCATTTTGTTTCCTGTTCTGCACAAGTTCTTTGCTCCTTAGACCATCTGCATCGTTTATTGTCTGTCCCCTAGTGTATTTGTATGGCTTACAATCTGAGAACATTCATCGACTGTGGGTGGAATCAACTGTATTTGTGGCATAGATTTAATGGGGTGTTATTAAATGTTCTCAGACACAGAGGAGAGGGCCGGTGAAGGGTGAGAGAGTAAGGACAGGCAAACAGGAATCTTCTGTAGTATCTTCAGATGCTTTTGTTTTGCTTAGTGGGATTTTTTTTTCTTTTAATTATAAATTGAGCCCAAGTATATTTACATTAAAGATTTGAAATTAGCTGGGTGTGGTGGCGCACACGTTTAGTCCCAGCACTTGGGGGAGTCAGGCAGATTTCTGAGTTTGA