Transcript asmbl_27787

Sequence
Transcript Sequence for observation asmbl_27787 of TGE0032880:
CGAGGTAGGTCCGGGTCCCGGAGGCTCCACCCTGAACTATATGGGCGATGAACCCTTGTGCAGTTACCTGCAGGCGCAGCGGGAAGCCACGCGTGCCCACGCCCCGCACATGGGAGCTTAGGAGATTGTGGGTGAGCAGTTTCATGTTGTCACAGCGGAGCGCGTGAGGCCGGAACCGGAAGGAGTCCACACTTCTCCTTTCTACCACTTCCGCTTTGAAGCCGTTGAACTCTTCGCCGGACCGGAAGTGGCCGACTTAGGGGACCTTTTGGGGGGCTTGGCGGCAGCCGAGATCGGAAGGACTGTGTTGGGTCACGTCCTGGTACCGGAAGCGTTTCTCGGGGAGACTGCAAAGGCTTACGCCGAATCCCGCTCGCTGAAGAGAGTACACACTATGCAAGTCACGTGTAAACCGGCTGCGTTACGGCGCAGGTAAAACGAACACATTTGAGGCTCAGCCAGATCATCCCCGACCTCTGTTTGCGGCTATGGGTCACGAACTGTCACGTCGGTAAACCAGGCACCTCTTTCTGCGATTGAAGAAGGTGTGCGAGCCCTGAGAGCCCCGCCGCGTCGTAGTGCGTCACGGCCCTGCCCCTCTAAGCCGGCGCTGTGGCTGCGACGTGGGACGTGCGGCGTGGGCGGAGCTGTCCCTGCATCCACCTCCTGTGGGCAGAGCCATCTGCGGGTGGGCTGCGGCAGCGGGGCGGGTATGCTACAGCTGGGGCTTCGAGTCCTGGGCTGCAAAGCCAGTTCTGTGCTCCGTGCATCGACGTGCTTGGCAGGCAGAGCAGGCCGGAAAGAAGCAGGTTGGGAGTGTGGCGGAGCCCGCAGCTTCAGCAGCTCCGCGGTGACCATGGCCCCGATCAAGGTGGGAGATGCCATTCCCTCAGTGGAGGTATTTGAAGGGGAACCGGGAAAGAAGGTGAACTTGGCAGAGCTGTTCAAGGGCAAGAAAGGTGTTTTGTTTGGAGTCCCTGGGGCATTTACACCTGGCTGTTCTAAGACCCACCTGCCTGGGTTTGTGGAGCAAGCTGGAGCTCTGAAGGCCAAGGGAGCGCAGGTGGTGGCCTGTCTGAGCGTTAATGACGTCTTTGTGATTGAAGAGTGGGGTCGAGCCCACCAGGCAGAAGGCAAGGTTCGGCTCCTGGCTGACCCCACTGGAGCCTTTGGGAAGGCGACAGACTTATTATTGGATGATTCTTTGGTGTCTCTCTTTGGGAATCGTCGGCTGAAAAGGTTCTCCATGGTGATAGACAACGGCATAGTGAAGGCACTGAACGTGGAGCCAGATGGCACAGGCCTCACCTGCAGCCTGGCCCCCAACATCCTCTCTCAACTCTGAGGCCCTGGCCAGATGTCCTCTGACTCTCCCATCTCTCCCACCCGGCTCTAGGCCAAAAGGCTCGGTACCTCCTTACTGGGAGCCACGTAAATGGAACCTTGACCATATTTCTGCAATAAACAGTTTAATTTGTGTCTTTA