Transcript asmbl_22996

Sequence
Transcript Sequence for observation asmbl_22996 of TGE0042683:
AAGATCTGTTTCAGCCTCTATCCTATATAAAACAGTCAAAACAGGGATGTGGGAGAATGAAGAGACAAAGCCCAGGGCCCAATAGGTCAAAACTACAAGATATGCTTGCTAATTTGAGAGACGTTGATGAACTTCCCTCCTTGCAGCCATCTGTTGGCTCCCCTTCCAGACCCAGCAGCTCCAGGCTTCCAGAACAGGAGCTCAGTAGGGCAGATGAAGTGGAAGCGCTGACATTCCCCCCTTCTTCTGGGAAGTCATTTATCATGGGAGCAGACGAAGCCCTTGAGAGCGAGCTGGGGCTTGGAGAATTAGCAGGCCTCACGGTGGCCAATGAAGCAGACTCACTAGCTTATGATATAGCGAATAACAAAGATGCCTTGAGGAAGACGTGGAACCCTAAGTTTACATTAAGGAGTCACTTTGATGGCATCCGAGCCCTTGCTTTCCACCCCATTGAGCCTGTGTTAATAACAGCCTCAGAGGACCATACGCTGAAAATGTGGAATCTACAGAAAACAGCCCCAGCCAAAAAGAGTACTTCTCTAGATGTGGAGCCTATCTATACATTCAGGGCTCACAAAGGCCCGGTGCTGTGTGTGGTCATGAGTAGCAATGGTGAGCAGTGCTACAGCGGCGGGACTGACGGGCGGATCCAGAGCTGGAGCACCACCAATCCCAACGTCGATCCCTACGACGCTTACGATCCTTCAGTTCTAAGAGGCCCTCTGCTGGGCCACACGGACGCGGTATGGGGGCTGGCCTACAGTGCGGCACACCAGCGCTTGCTCTCCTGCTCAGCAGACGGCACTCTTCGCTTATGGAATACAACTGAGGTTGCTCCAGCACTGAGTGTATTTAATGATAACCAAGAGCTGGGAATTCCTGCCTCTGTGGATCTGGTGAGCAGCGACCCGAGCCATATGGTAGCATCGTTCAGCAAGGGATATACAAGCATCTTTAACATGGAAACACAGCAGCGAGTTCTCACGCTAGAATCCAATGTTGATTCAACATCCAGTTCTTCCTGCCAAATAAACAGAGTCATCAGCCATCCTACCCTCCCAATCAGCATCACTGCTCATGAAGACAGGCACATCAAGTTCTACGATAACAATACAGGCAAACTGATCCACTCGATGGTGGCCCACCTGGAAGCTGTGACAAGCCTGGCAGTTGACCCGAATGGCCTCTACTTGATGTCTGGCAGTCATGACTGTTCAATACGCTTATGGAATTTAGAAAGTAAGACATGTATCCAGGAGTTCACAGCTCATCGGAAGAAATTTGAAGAATCGATCCACGATGTAGCGTTCCACCCTTCCAAATGCTATATAGCCAGCGCTGGAGCCGACGCCCTGGCTAAGGTCTTTGTATGATGTGGCACAGCAGCTTCACCTTGTAGCTCTTTATAAAAGTCAACTGCACAACAGCGATACGGAAGACCAGGGCAAGAATCAGCTCGCCCTGCCCTTTTGTTCTGCTGAGGGAGCACAGAGAACTCTGTTAAAAGTATAGTTTTGCAATTCGTATACTGTTTTCTAAAATTAAGGTTTGTTCAGGTTGCTGCAAGCTCAGCCAAACCTGTGAGCCTGAAACTTTGAGATTTCCCTCCAAAGAGGCACTTTTGTTTCTGAAGTTGTTGTCATTCGCTAGGCTGGCCTGAGCGGGACAGGTTTAGCTTCTTCTCCCTTTCAAGTAAACAGGGCATGCTGTCATGGGTAATTAGAGTTGAGCGCCGGGAACGAGTAGAGTGGAAACCTCACTGTACTTCCTGCCACCCGGAGACATCTACTAGACACGAGGTAGTCAGTTGTACAGCTCTTTCTGCTCCACTAACCCCAGTGTGCAGAACGACCAGTCAGTGTTCAAGTGAGTTCCTACCACAGCTGTCCTTTCAGCCGCTCTCATAAAGCACATGGCAAAACATTTCACCTGCTAGGAGGAAACGATGCAATAATGTTAAGTGTATTACTATTCAGAAATGCTAAACAAATACTTAATTTGCAAGCAGATTTCTATATTGTACTACAGTTTTGAAAGTAGATGTGGAAGCATTCTAAAGTGAACTGTGAAGCACTCACAGTCAGGAGTGGGTACTAGAGCCTGCTTTACTAAAGGTTTGAACTCACCCAGGTTTGAGATCCTGTTTATTTTTAAGGGCAAACAGGGCATATTTCTATAATTTGTCTAAAAATTCACCTTGTTAATGTGGCATTTATAGTGCTAGCGTCATCATTTCATATTGATAAACTTACTTCCTAGTGATTCTGAAAAAGGGGAAAACTATTTATTAGCATCCATTTCCCAACACCCACATAACTAGTTCAAGTAAGCCTTGCTGTTTCTTCCCTGCCTTTCACGGTCATGTTGTCTGATGCTTACCATGAACAGTTTATAACTGGTCTGTCATGTAGTCCAAAGCATGTGGTCACTGCAGGCAGCTGCTTTTGCAGCCACGCCTAGTAGAGTAGTGCACCCCAGAAAGTCCTCTACTAGTGTCTCGGGAAAGAACTCTGTAGAGATCTAGATGGAGATGTTAGTGCCTGTGATGTCTACAAAGTTCTTTCTTCTCCCCACTCCCCATTGTTTAATTGGAATGCATGTTTTAATGAACAGTTGATCAATACTCTATCTAGAGAAAACCATGTCTTAAAATGCCAGCTCTCGCATTTATCTGTGAGCCGAATGTGGTCAGCTTTTGGGAGTCTCAGAATCCTACTGACACACCTAGGGCAGTCTTCACACCCTCTCTGCTTTTGTCCTAAATGACAGAGACCACTATAAATACTAAATTCAAATTAATCTCCACCTTTTTACCAAAATGTGTTCATCATAGGCTCTCTGTCTTAAAAATATTATACCCATAGATATTATGACCCATTAAACTAATTCCATTGCCATAGCCGTGGCTTTTCTGGTGATCTGTTCTTTGAAGTAGTATTCTTACGGTGATGTGGCTAATAATTGACTTCTTAAAAATTTCTGCTCATCTATCTTTAGAATTCTCCAGTGCAGGCAAACTTTTCTTACATTATAAGATTCGTGTTGAACGTCCCTGATTACTCTATAGACATGCTGTAGCACAACTACAGTTTATCTTTGTGCTTTGGTTAACAAGCAGGCTTTAGAGATTCACTGGTATATGCAAGTGAATTGAGTTACACATAACTACCAAGGAAAGCTCACATTTTCATGTATAGAGTTTTATGCTGTGACAGGTAAACTCTTCCATACTTTGTAAAGTGAACAAAAGGATTTATTAACATTTGTAGAATATTAGAAGATTCCAGTCGTAAGTGGCATATTTATGATGGCTGAGCACAGTTACTGCTTCAGTGTACGTCTTACTCTTGTCATCAACACTCCAGATCCCAGGAGAGTCTGCCCTGTTCATTCTGTGCCTCGTAATTGAAGTTTTCTTGTTAATGGGTGGGACACAATCCTAAGATAGGCAAAGTGTAGTACAAATGACAGAACTGTTGAAAGTTGTTTAGGAAGTATGTTTTGTGCCATTGAAGACTGCACGGAGAAAGAGAGCCTTCTAAACTAGCCCTGTTTGCTGTCAACCTAGAAATGAGCCAACTGTCTTCCAACTGGATGGTAGCATGTACGTGTGTTTGACTTTCCCCATCCTATTGAAAAATCACAAGATGAACAGTTTCAAGATTCAAAACCCTTGAAATACTTTCATGGTTATTTACCAGATTGTAAATGTTTTGAGTGAGCTGTTTTGGAATAATATGAAAATCAGCAGGTAGGTTAGGTCCCTGCCTTATTTTCAGTGCTGTGGATGTGTCTCCGGGAGCTTACAGTACTTCTCAAAATGCAGCTGTCACTTGGAGCTCATTTGCTACTCAAACCATAGACAAATAGGTGATGGGATGACCTTCAGTATTTTTCTATTGAACAAAGTTACCAATTTTTGCCATTAAACAGATAATTAGTTATGCAAAGTATTTAGCTTTTGTAATCATTTAGTTGTAACTAAAAGGGGGAAATTGAGCTGTATCACTGATAATGAACTTTGTGAGAAATTATTTGTTTATCTGACTTCCATTCCTTCAGTATTCTTGCTATAAATTTCTTTTGGAGATAATGATTCTTTATTTGAAAGATG