Transcript asmbl_50085

Sequence
Transcript Sequence for observation asmbl_50085 of TGE0006102:
GCAAGGACAAGCCTGACCAAACTGACTTGCAGGTCTTTTCAATAACTGGTCTTTTCAGTCCCCAGTGTCTGTGAGGAAAGGGGAGACGGCCGTTTGTCAGAACCTCCGTGCTGTTATTCTTCCTGCGTTCGACTCCTGACTTGGCTTTTATGCCATTGTTTATCCCCTCTTCTGTACTTGGATCCCTCGGGGTGTGTGTTTCCAGGAACAAGAGTGTATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAACTGTTCCAACAGAGTTTTTAAGCCCACCCGACTACCCGAGCTCTTCCTCTTCAGCGTCTCTAAATATTGAAAAAGAGACCAGCCCTC