Transcript asmbl_50080

Sequence
Transcript Sequence for observation asmbl_50080 of TGE0006098:
GCAGCACTCGCGGCGCCGCAGGACATGAATGCAGTCCAAGTCCTGGGGGTGCCCGGGGGGCATCGTAGCGAAATTGCCTTGCTGGTCCATTGGGAGCGCGTCCAGAACCCCAGGCTTAGCTCTCTTTGCAACACCCAGCCAGGTCCCCACCGGGCACCTGGCCGCGCTCGGCTGTCCGGTCGCGGGCATGCTGCCTTGAGCCGCTGACCCCGCTGGAGACCCTGCATGCCAGCCTGGCCTGAAAACGGAGGACTCCACAGACCCGGTCCTCCCCACACCTCTTCTGCACAGAAGCAAACCCTCCTGACTTAGCCACGGCTTCCAGAACCTCTGAGACGGGAGGCCCCCAGGTTTACCTCATGTTTGGGGCATCTTGCTAGCTATGGCCCTGATCCTAGGCTTCTTGCTGCTGCTGGGGCTGGGCGGGAATACCATTTCAGAGGAGCCGCTGTCATCCAAAAGGACTACTTCTGATGTTCTGGAGTTTAAACTCCGGGAAGTGAAGTATGAGACCGAAGACTCTTATAAACTTGGACCCATTGGCATTCTCTTTCAAGTAGTGCACGTCTTTCTCCACGTGGTGCAGCCCAATGCTTTCCCCGAGGATATTCTCAAGAATGTATTACGAAACAAGTTTGACCTCTCAGCTGATTATAAGAAGATCATCCAGTATGAGCTGGGGATCATTATCTGCGCCGTCCTTGGCCTGCTCTTCATTATTCTGATGCCTCTGGTGGGGTTTTGCTTTGGTTTGTGTCGTTCCTGTAACAAGTGCGGTGGAGAAATGCACCAGCGACAGAAGAGAAACGGGACCTGTCTGAGGAAATACTTTGCAGTCTCTCTCTTGGTGATTTGTATGTTTATAAGCGTTGGTATCATCTATGGTTTTCTGGCAAACCACTACCTGAGGACCCATATCGAAAAGACTCAAAAACTGGTAGACAGCAACTTCAGAGACTTGAGAACTCTCCTGGACGAAACTCCAATGCAAATCGACTATGTACTGGACCAGTATAACACCACTAAGGAAAAGGCATTTTCAGATCTGGACAATGTTAAATCATTGCTGGGAGGCAGAATTCGCGATCAGCTAAGACCTAAAGTGATCCCTGTTCTTGATAACATCAAGGCCATGGTTGAAGTAATCAAAGAGACCAGAGAAGCCCTGTCGAACACGAACAATGCCTTAAAGGACCTGAAAAAATCAATTGCACAACTTGACACCAGCCTGAGTGACGTTAAAACGGACCTGGAGCAGGCACTCAGTGACCCCCTGTGCTCTATACCTCCAATAACCACCACTTGCAACGAGATCTCAATGACTCTAAACCAGCTGGATAACAACACTGACGTGGGAAAGATTCCCTTGTTGGATAATCAACTTGATAATGTTAATCATGTTCTTCAAACAGATTTGTCTAGCCTGGTCCAGAAGGGCTATCAAGCCTTTGATGACATACCTGAGATGGTGCAAAACCAAACCACGAACATAGTATTAGATATCAAAAGTACCTTGAATTCCATTGGTTTAGATATCAAACAAAAAAATGAACAGATTTCTATTCAGAATAAGCTGTCACGTTTCATGGATCCCATTAATTACGTTGAAAGTTATATCTACAACAAATTACGCAAGTTGAAAGAATATGACTCATACAGGTGGCTGAGCAGCTTGGTTATCTGCTGTTTCCTGACACTCGTCACGACTTTTTATTCCTTGGGCATATTATGTGGCATTTTTGGCTATGACCCGAATGCCTCCCCAACGAGAAGAGGTTGCATCTCCAACACCGGGGGCATCTTCCTCATGACTGGGGTTGGAATCAGTTTCCTCTTTTGTTGGCTATTGATGATCATTGTGGTTCTTACTTTTGTTATTGGCGGAAATGTGGAAAAATTGGTCTGCGAACCTTACCAGAACAGGAAGTTATTCCAGGTTTTGGACACACCGTATTTACTAAATGAGAATTGGAAATACTACCTCTCAGGCATAATATTTAACAAACCGGATATCAATCTTACTTTTGGACAAATATACAGCGATTGCAAAGAAAATAAAGGCATATATGCCACACTGAAGCTGGAAAACCGCTACAATATCAGTGAATATCTCAACGTTCAGGAGTACACCGAGAACATAAACAGTTATTTTGACAATCTCAACATAAAGATTGATAACATCGTTCTGCTGGACGACGCGGGAAGAAGAAGTCTCATGGATTTCGTTTCTTCAGGCGTAGATAGAATAAATTATGACGCTTACTTGGCTGAGACAACTAAAGCACCCACAAAAGTGAATCTTTTATTATTTGCAGATGTCCTACAAGAGAAAGCCAACCAATTGCCCCCAGGAAACTTGAGATCGTCCCTGATAAGAAACGAACAGATGATTAGAAGGATTTACCATGACCAAGTCATACCTCTGGAACTATCGATGAAAGGTATATACCGAAGCATCCAGGAGCTTCAATACAAAAGCAGTGGATTGGGGGCGAGTGTGAGCGATATCATTTCCTCTTTGGATTCAGCTCAGAAATTCATCGTCAAGAATATTTCCTCTATTATCATTAAGGCAAGTAAGAAGTATGGGAATACGATACTTGGATATTTTAAACTTTATCTGCAGTGGGTCAAGGTCTCAATCACTGAGCAAATCGCGGCCTGCAAACCTGTGGCCACCGCATTAGATTCTGCTGTGGACGTCTTTCTGTGCAACTACATTGTCGAACCCATGAATCTGTTTTGGTTCGGCATAGGAAAAGCGACCATATTTTTACTTCCAGCAATCATTTTTGCTGTAAAGCTGGCCAAGTACTATCGTCGAATGGATTCAGAAGATGTGTATGATGATGTTGAAACTGTCCCCATGAAAAAGTAAGCCTTTTCTTTTTTAAACCGTATTCATAAGCTCAGATGGGGGGGAGGCTCTTTATTATTATATGATGGACTTTTTAAATTAAGAACATCTTAAAATGAGGTAACGACAGTAGGCGTGCCCAGATTAAAATAAATGCTGATGTCTGTTGAAATAAGGACTGGTAAATAAGGACTGGGCGTTGAAGAAGTATTTGTCGAATTAATGAAAATTTTGTGTGTTAAATTTATGAATATACAAAAGGGTTGTTTTGAGATTTGATCTTTAAAGGGAGCAACATGTAAATATGCCCTTTGGCCTTTTTTTGTGTATTTGACAAGGCGTCAGATATTTTTCATGACTCTTACATTGTCTTTGTCATCCACGATATCGATACTTTGTCTTAGTAATAACATGGTGTTTGTGATGTATTTGTTTTTGTCACAGTATGCAAAAGGGTAATGTTGATTTTAATAGCCATCAAACCGCTCAGACTGTTCCAACAGAGTTTTTAAGCCCACCCGACTACCCGAGCTCTTCCTCTTCAGCGTCTCTAAATATTGAAAAAGAGACCAGCCCTCTAGGAGATGACAGACTTGGCGACACCGTCTAGGACACTCACCGATGGGTCCGAGAGGGAAAAGTGTACCCACCTATCTTCCATCTGTAGAAGTCTGGCTTGATCATCCGAGCCTTCTATGAAAGTTGAAACGTGTACCACGTTCACTAATTTTCAGCTTTGCCTTTGGAAGCAGAAATGAATTTTGTCACATTTCATTGCATGGGAACTTAGACTTGTAGTTAGAGAAAGTTCAGCAAGTAGCAGATATGTATATAAGCAATAAAAGAATGATTTCAGAAA