Transcript asmbl_22083

Sequence
Transcript Sequence for observation asmbl_22083 of TGE0032516:
ATGGGATGCGCAGGCGCAGAACTCTCCCAGCAGAAAGCCCTCGGAGCCCGGGGGCCGGGCGCGGGGCCTTGTGGGAGGGCTTAAGGAAGTAAAATGGCGGACCTGGCGAACGAAGAAAAGCCTGCCGTCGCACCGTCTGTCTTTGTGTTTCAAAAGGACAAAGGACAGAAGAGATCTGCTGGCAGCTCCAGTCCCGAAGCCGGAGAAGATTCTGACCATGAGGATGGAAACTACTGCCCCCCTGTCAAGCGTGAGCGGACATCCTCTCTAACTCACTCAGAAGAGAAGAGCAGCGGCTTCCGGCTGAAGCCCCCAACACTCATCCACGGTCAGGCACCCAGTGCAGGTCTGCCCAGCCAGAAACCCAGGGAACAGCAGCGTGGTGTGCTCCGTCCAGCTGTGCTGCAGGCCCCTCAGCCCAAGGTGCTGTCGCAGACGGTTCCCAGCAGTGGCACCAATGGAGTCAGTATGCCAGCAGACTGCACGGGGCCAGCAACGTCTGTATCACCAGAAAACCTCACGCAGAGGAGTCCCTCTGAGTCTGCCGAGGAGACACACACACTCGAGGAGAAGGTGCCTCAGAAAACCCCACATGGCACCTCAGAGGAGGGGCACTGTGAAGAGGAGCAGGCGGCCCCACAGGCCTTTGTGTTTGGACAGAACTTGAGAGACAGAGTGAAGTTAATGAATGAGAATGCCAGCGTGGCAGATGTAGACAGTGCTGCACATCCCAGCTCAGAAACACCCTCTGCGACCAACTACTTCCTTCAGTACATCAGTTCCAGCGCAGACAACGCGACCCACAGTGCTGACAACTCCACCAAGTTTGTGTTTGGCCAGAACATGAGTGAGCGCGTCTTGAGCCCCCCAAAGCTGAATGAAGCCAATTCAGACACCAGCAGGGAGACTACACATGCCCAGTCAGGTTCTGAGTCGTCATCCCAGGAGGCCGCCCCCAAGAAAGAGTCCCTGGCAGAGTCAGCCGCTGCCTATACAAAGGCTACAGCGTGGACGTGTTTGCTGGAGAAGGTGGAGGTCATCACGGGGGAGGAGGCAGAGAGCAATGTGCTGCAGATCCAGTGTAAGCTGTTTGTGTTCGATAAGACCTCACAGTCATGGGTGGAGCGTGGCCGGGGACTTCTCAGGCTCAATGACATGGCGTCAACCGACGATGGCACATTACAGTCCCGGCTAGTGATGCGGACCCAGGGCAGCCTGCGGCTCATCCTGAACACGAAGCTGTGGGCACAGATGCAGATGGATAAGGCCAGTGAAAAGAGCATCCGCATCACAGCCACCGACGCTGAGGACCAGGGTGTCAAGGTTTTCCTGATCTCGGCCAGCTCCAAAGACACAGGCCAACTGTATGCTGCACTGCACCACCGCATCCTGGCTCTGCGTAGCCGGGCTGAACAGGAACAGGAGGCCAAGGCGCCCCCACCTGAGCCAGGAGCCACCCGGGCCACCGAGGAGGAAGACAGTGATGAGGATGCTGTTCTGGCTCCCTCCGGTGTCACGGGGGCTGGCACAGGTGATGAAGGAGATGGCCAGGCTCCTGGGAGCACATAGCGGCGGAGCCACTGCACCAGGCTGCTGCTTTGTTGTCTGTCTGCTGCCCGTCCCTCCCTGCAGGCCGCATCATGGTGGTGTCTATTGCCGGGGTGGCCACAGGCTGGATCCGAGTGTCCCCTCTGCAGCAGACGGGGACGCCAGGATGCGGCTTGGGACTCAGACCTCATCATATTGATGAGTAGAAAGAACGTTCCCCCGCCCTCCTCCGATCGAAATGGCACATTGACACTTGTCACAGCTTCGTGGTGACCGTCCATCCCTGGGCAGCAACAAAGAGAACTCCAGGCTCAGCATTCTGTTGAGTAACTTGCTACCTGCTCGGCTTTCCACTCTGCCAGGTCCACATGGCAGGTGCCTCTCCTTCATTTCTGGTGGCTTGGCTCTTGAGGTCACAGATGAAGCTACACGTGGGCTGAGCTGACTTGATGCTCCTATGGGTGGTGCCCGGCCCCCACGGGGGTTCACTAGGTTTGGGCCTGAGAACACCTGTCTGGACAAAGGTGATGAAACCAAGAGAGCTCCTGCCTTCTTGCCTGCCTACGTGAACCACCTGGGTCTCCCTTAGCAGGTACCCAGCCCTGAGGTGACTGACCACCTAGGGCCCCTGAGAGGCAAAGGGAACCTGCAAAGGGCCTGTCCCCGGGCAGAAGATGAAGCCCCTACCCGTGGACTGTGTGGTTCCATCTCTGGCCAGGCCACTTCCAGCCAGCAAGGACACCAGAGGCTGCCTTAGCAGATGGGTCACACTGCTTCCAGCCTTAGCCAGCCAGTGACAAGTGAATCCAGACGTCACCCATGTGTTTTGGAACATTTATGTAAGATTGAAATGTATTTGAGAACTGCATTAAAACTTTTAACTAAA