Transcript asmbl_21966

Sequence
Transcript Sequence for observation asmbl_21966 of TGE0032507:
CCGAGCTCCTGCGGCGAGCGGGTGTGACCCCGGCGTCTGGGTTCGGTTCTGAAGTCCGGGCTTGGTCCGGGTGATCCCCAAACACTGACCGTTCTCATTTCCTTTTGGGAGTATTCATGCTTCACCATGTTGAGAGCTAAGAATCAACTTTTTTTGCTATCGCCCCATTACCTGAAGCAGCTAAACATTCCATCAGCTTCCAGATGGAAACGCCTTCTACACCAGCAGCAACCCCTTCACCCAGAATGGGCTGTACTGGCCAAAAAGCAGCTGAAAGGCAAAAACCCAGAGGACCTTATATGGCACACCCCAGAAGGGATCTCTATAAAGCCCTTATATTCCAGGGCAGATACTCTGGACTTACCCGAAGAACTTCCAGGAGTGAAGCCATTCACACGGGGACCATATCCTACCATGTATACCTATAGGCCCTGGACCATCCGTCAGTATGCAGGCTTTAGTACTGTGGAAGAAAGCAATAAATTCTATAAGGACAATATTAAGGCTGGTCAGCAGGGGTTGTCTGTTGCCTTTGACTTGGCAACACATCGTGGTTATGATTCAGACAACCCCAGAGTTCGTGGAGATGTTGGAATGGCTGGAGTTGCTATTGACACTGTAGAAGACACCAAAATCCTATTTGATGGCATTCCTTTAGAAAAAATGTCCGTTTCCATGACTATGAACGGAGCTGTCATCCCAGTCCTGGCAACATTTATAGTAACTGGGGAAGAGCAAGGTGTGCCGAAGGAGAAGCTCACTGGCACAATTCAGAATGACATCCTAAAGGAGTTTATGGTCAGAAATACTTATATTTTTCCCCCAGAGCCATCGATGAAAATTATTGCTGACATTTTCCAATACACAGCACAGCACATGCCAAAATTTAATTCCATTTCGATTAGCGGGTACCATATGCAGGAAGCAGGAGCTGATGCCATTTTAGAACTGGCCTATACCATCGCAGATGGGTTGGAGTACTGCAGAACTGGACTCCAGGCTGGACTCACAATTGATGAATTTGCACCAAGGTTGTCTTTCTTCTGGGGAATTGGAATGAACTTCTACATGGAAATAGCCAAGATGCGAGCTGGGAGAAGACTGTGGGCTCACTTAATAGAAAAAATGTTCCAGCCTAAAAACTCTAAATCTCTTCTTCTAAGAGCACACTGCCAGACATCGGGGTGGTCACTTACTGAGCAGGATCCTTACAATAACATTGTCCGCACTGCAATCGAAGCCATGGCAGCTGTGTTTGGAGGAACCCAGTCTTTGCATACGAACTCTTTTGATGAAGCGCTGGGTTTGCCCACTGTGAAAAGTGCCCGGATTGCTCGGAACACACAGATCATCATTCAGGAAGAATCTGGGATCCCCAAAGTGGCGGATCCTTGGGGAGGGTCGTACATGATGGAGTCGCTCACAAATGACGTTTATGAGGCTGCTCTGAAGTTGATATATGAAGTTGAAGAAATGGGTGGAATGGCCAAAGCTGTAGCTGAAGGAATCCCTAAACTTCGCATTGAAGAATGTGCTGCCCGAAGACAAGCTAGAATAGATTCTGGTTCTGAGGTAATTGTTGGAGTAAATAAGTATCAGTTGGAAAAAGAAGACTCTGTGGAGGTCCTGGCCATTGACAACACTTCAGTGCGTAAGAAGCAGATTGAAAAACTCAAGAAGATTAAATCCAGCAGGGATCAAGCTTTGGCTGAGCAGTGTCTCAGTGCACTTACCCAGTGTGCTGCCAGTGGAGATGGCAATATTCTGGCTCTGGCAGTGGATGCAGCTCGTGCAAGATGTACAGTTGGAGAAATCACGGATGCCTTGAAAAAAGTATTTGGTGAGCATAAAGCTAATGATCGTATGGTGAGTGGAGCATATCGGCAGGAGTTTGGAGAAAGTAAAGAGATCACATCTGCCATCAAGAGAGTTAATAAATTCATGGAACGTGAAGGTCGCAGACCTCGTCTTCTTGTGGCAAAAATGGGACAAGATGGCCATGACAGGGGAGCCAAGGTCATTGCTACAGGATTTGCTGATCTTGGTTTTGATGTGGACATAGGCCCTCTTTTTCAGACTCCCCGTGAAGTGGCGCAGCAAGCTGTGGATGCAGATGTCCATGCTGTGGGTGTCAGCACACTTGCTGCTGGTCATAAAACCCTCGTTCCTGAGCTTATCAAAGAACTCACCGCCCTGGGGCGGCCAGATATCCTTGTCATGTGTGGGGGCGTGATTCCACCACAGGATTATGAATTTCTGTATGAAGTTGGTGTTTCCAACGTCTTTGGTCCTGGAACCCGGATTCCAAGAGCTGCTGTCCAAGTGCTTGATGATATTGAGAAGTGTTTGGCAGAGAAGCAGCAGTCTGTGTAACATCTGGATCTTTAGTTATGACTGAAGCAGCAGTCTGTGTAACATCTGGATCTTTAGTTATGACCGAAG