Transcript asmbl_20170

Sequence
Transcript Sequence for observation asmbl_20170 of TGE0007598:
GCGCCCTCGGCCTCGTTGCCGCTTTTGGGGCGGTACTCTGCCCTGTCTTACTTTTCTCCACGTGAGGGGGTGCGCGAATCCCCAGTGGTGGCCGCGCGCTCACATCCTCTGCAGCTTTCGTGCCCTTCGCGATGGCGGGCATCCTGTTCGAGGATATTTTCGATGTGAAAGACATCGACCCAGAAGGCAAGAAATTTGACCGAGTATCCCGGCTGCACTGTGAGAGTGAATCTTTCAAGATGGACCTCATCTTAGATGTAAACATTCAGATTTACCCTGTGGACTTAGGTGACAAGTTCCGGTTGGTTATAGCTAGTACTTTGTATGAAGATGGTACCTTGGATGATGGTGAATACAACCCCACAGATGACAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTCATGTATGGGAAAGTGTACAGGATCGAAGGGGATGAGACCTCCACTGAAGCAGCCACACGCCTCTCTGCGTACGTGTCCTATGGGGGCCTGCTCATGAGGCTTCAGGGTGATGCCAACAACCTGCATGGATTTGAGGTGGACTCCAGAGTTTATCTGCTGATGAAGAAGCTGGCCTTCTGAACTTCGTGGGAAACCAGACTTGCTGCTTAGTCACTCATGTCATGGACACTGTTCAAGGCTGTGTAGAAGCTGTCGGTGTTAGCCTGTAAAAGGGGCGGAACTCTGTCCACTGTGGGGACGTCTTCAGTTTGTCTGAATGCAGTGGAAAACCGACTCTCCCTCTCGGAAGGCCGAGAGGGAGAACTTAGCATGAACCTGAAGTTGTATATGATTTTTTTTATTAAAGTTTTCTTTTTCA