Transcript asmbl_49831

Sequence
Transcript Sequence for observation asmbl_49831 of TGE0006078:
CGCAGAGCCGCTGTAGTCTCGCGCGGCGGTTGCGAGCGCGTGAGGGACCTGTGCTGCGTTGCGTGCGGTTAGGCAGCAGCGGCAGCAGGAGCAGCAGCAGCTGTGTATAGGAGTCATGAAACACCACGAGGTGGAGATTCTGGACGCGAAGACACGGGAGAAGCTGTGCTTCTTGGACAAGGTGGAGCCCCATGCCACCATCGCCGAGATCAAGAATCTTTTCACTAAGAGCCATCCGCAGTGGTACCCTGCCCGCCAGTCCCTCCGTCTGGACCCTAAGGGCAAGTCCCTGAAGGATGAGGATATTCTGCAGAAGCTGCCTGTGGGTACCACGGCCACACTTTACTTCCGAGACCTGGGGGCCCAGATCAGCTGGGTGACGGTGTTCCTGACAGAGTACGCGGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGGTGCCCTTCATCTATGGCCACAAATATGACTTCACGTCCAGCCGGCACACGGTGGTGCACCTCGCTTGCATCTGCCACTCATTCCACTACATCAAGCGCCTTCTGGAGACACTCTTCGTGCATCGCTTCTCTCATGGCACCATGCCCTTGCGCAACATCTTCAAGAACTGCACCTACTACTGGGGCTTCGCTGCGTGGATGGCCTATTACATCAACCACCCTCTCTACACGCCCCCCACCTATGGAGCTCAGCAGGTTAAACTGGCACTTGCCATCTTTGTGATTTGTCAGCTGGGCAATTTCTCCATCCACATGGCCCTGCGGGACCTGCGGCCAGCAGGGTCCAAGACCAGGAAGATCCCCTACCCCACTAAGAACCCCTTCACATGGCTTTTCCTGCTGGTGTCCTGCCCCAACTACACCTATGAGGTGGGGTCCTGGATTGGCTTTGCCATCATGACACAGTGTCTCCCAGTGGCCCTCTTCTCCCTGGTGGGCTTCACCCAGATGACTATCTGGGCCAAGGGCAAGCACCGCAGCTACCTGAAGGAATTCCGAGACTACCCACCCCTGCGCATGCCCATCATCCCCTTCCTGCTCTGAGCTGCCCACCCCACTGGCTAGGCTCCGCCAGGCTTTCATCCCCCCACCCCTTGTCCTTTTGGGAGAGAAGTGAGGACCACTGCTCTTCAGCGCATGGAATAAAACCTGCCTGCATAGCCGG