Transcript asmbl_10997

Sequence
Transcript Sequence for observation asmbl_10997 of TGE0000061:
CCCCGCCCCCTCTCCGCCCCGCCCCGGCTCGGGCGGCCGGAGGACCCGGAGCTAAGGCGCCCGAACCCGCGGCGGCGGTGGGGACGATGTGGTTCTTTGCCCGGGACCCGGTCCGGGACTTTCCGTTCGAGCTCATCCCGGAGCCCCCAGAGGGCGGCCTGCCCGGGCCCTGGGCCCTGCACCGCGGCCGCAAGAAGGCCACAGGCAGCCCCGTGTCCATCTTCGTCTATGATGTGAAGCCTGGCGCGGAAGAGCAGACCCAGGTGGCCAAAGCTGCCTTCAAGCGCTTCAAAACTCTACGGCACCCCAACATCCTGGCTTACATCGATGGACTGGAGACAGAAAAATGCCTCCACGTCGTGACAGAGGCTGTGACCCCGTTGGGAATATACCTCAAGGCGAGAGTGGAGGCTGGTGGCCTGAAGGAGCTGGAGATCTCCTGGGGGCTACACCAGATCGTGAAAGCCCTCAGCTTCCTGGTCAACGACTGCAGCCTCATCCACAACAATGTCTGCATGGCCGCCGTGTTCGTGGACCGAGCTGGCGAGTGGAAGCTTGGGGGCCTGGACTACATGTATTCGGCCCAGGGCAACGGTGGGGGACCTCCCCGCAAGGGGATCCCCGAGCTTGAGCAGTATGACCCCCCGGAGTTGGCTGACAGCAGTGGCAGAGTGGTCAGAGAGAAGTGGTCAGCAGACATGTGGCGCTTGGGCTGCCTCATTTGGGAAGTCTTCAATGGGCCCCTACCTCGGGCAGCAGCCCTACGCAACCCTGGGAAGATCCCCAAAACGCTGGTGCCCCATTACTGTGAGCTGGTGGGAGCAAACCCCAAGGTGCGTCCCAACCCAGCCCGCTTCCTGCAGAACTGCCGGGCACCTGGTGGCTTCATGAGCAACCGCTTTGTAGAAACCAACCTCTTCCTGGAGGAGATTCAGATCAAAGAGCCAGCCGAGAAGCAAAAATTCTTCCAGGAGCTGAGCAAGAGCCTGGACGCATTCCCTGAGGATTTCTGTCGGCACAAGGTGCTGCCCCAGCTGCTGACCGCCTTCGAGTTCGGCAATGCTGGGGCCGTTGTCCTCACGCCCCTCTTCAAGGTGGGCAAGTTCCTGAGCGCTGAGGAGTATCAGCAGAAGATCATCCCTGTGGTGGTCAAGATGTTCTCATCCACTGACCGGGCCATGCGCATCCGCCTCCTGCAGCAGATGGAGCAGTTCATCCAGTACCTTGACGAGCCAACAGTCAACACCCAGATCTTCCCCCACGTCGTACATGGCTTCCTGGACACCAACCCTGCCATCCGGGAGCAGACGGTCAAGTCCATGCTGCTCCTGGCCCCAAAGCTGAACGAGGCCAACCTCAATGTGGAGCTGATGAAGCACTTTGCACGGCTACAGGCCAAGGATGAACAGGGCCCCATCCGCTGCAACACCACAGTCTGCCTGGGCAAAATCGGCTCCTACCTCAGTGCTAGCACCAGACACAGGGTCCTTACCTCTGCCTTCAGCCGAGCCACTAGGGACCCGTTTGCACCGTCCCGGGTTGCGGGTGTCCTGGGCTTTGCTGCCACCCACAACCTCTACTCAATGAACGACTGTGCCCAGAAGATCCTGCCTGTGCTCTGCGGTCTCACTGTAGATCCTGAGAAATCCGTGCGAGACCAGGCCTTCAAGGCCATTCGGAGCTTCCTGTCCAAATTGGAGTCTGTGTCGGAGGACCCGACCCAGCTGGAGGAAGTGGAGAAGGATGTCCATGCAGCCTCCAGCCCTGGCATGGGAGGAGCCGCAGCTAGCTGGGCAGGCTGGGCCGTGACCGGGGTCTCCTCACTCACCTCCAAGCTGATCCGTTCGCACCCAACCACTGCCCCAACAGAAACCAACATTCCCCAAAGACCCACGCCTGAAGGAGTTCCTGCCCCAGCCCCCACCCCTGTTCCTGCCACCCCTACAACCTCAGGCCACTGGGAGACGCAGGAGGAGGACAAGGACACAGCAGAGGACAGCAGCACTGCTGACAGATGGGACGACGAAGACTGGGGCAGCCTGGAGCAGGAGGCCGAGTCTGTGCTGGCCCAGCAGGACGACTGGAGCACCGGGGGCCAAGTGAGCCGTGCTAGTCAGGTCAGCAACTCCGACCACAAATCCTCCAAATCCCCAGAGTCCGACTGGAGCAGCTGGGAAGCTGAGGGCTCCTGGGAACAGGGCTGGCAGGAGCCAAGCTCCCAGGAGCCACCTCCTGACGGTACACGGCTGGCCAGCGAGTATAACTGGGGTGGCCCAGAGTCCAGCGACAAGGGCGACCCCTTCGCTACCCTGTCTGCACGTCCCAGCACCCAGCCGAGGCCAGACTCTTGGGGTGAGGACAACTGGGAGGGCCTCGAGACTGACAGTCGACAGGTCAAGGCTGAGCTGGCCCGGAAGAAGCGCGAGGAGCGGCGGCGGGAGATGGAGGCCAAACGCGCCGAGAGGAAGGTGGCCAAGGGCCCCATGAAGCTGGGAGCCCGGAAGCTGGACTGAACCGTGGCGGTGGCCCTTCCCGGCTGCGGAGAGCCCGCCCCACAGATGTATTTATTGTACAAACCATGTGAGCCCGGCCGGCCCAGCCAGGCCATCTCACGTGTACATAATCAGAGCCACAATAAATTCTATTTCACACCCCTTGTGCCG